Description :
From Genome Similarity Track
Location :
Scaffold_586:1209- 2232
Transcript NameFunction/comments
g16212.t1hypothetical protein

Sequence
1023 bases(100 bases per row)
GACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTACATCGTA
TCAACGAAGCCGTAGCGGATCGCATGACTGGACCAGCTCGAGAATATGTGTCCACAGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGA
GGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTG
GGGTTGTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCACGCCACTATCATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGA
TCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTTGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGAT
CAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACG
TCGAGGTCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGGG
CGTAGGCAGCGACACATACTGAGGAGGCGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAG
TGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGACTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCGTGTG
GTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGG
GTTCGTACACACGGGAACAATGT