Description :
From Genome Similarity Track
Location :
Scaffold_607:12083- 13085
Transcript NameFunction/comments
g16376.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
ACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAACACATGCTGGATGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGG
CACAATGAAGCGCGGAGCAAGCAAGCTTGCTCCAAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAAT
TCATTTGTGTTTCCACTGCCGGTGTTATCGGCATTCAGCTTCTGTTGATTGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGACTTGTCGGC
GCTGGACAAAGTCCATTGCATCCGAGCTGAACTCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAA
AGTGTCTACGCCCATCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGC
TTATCCGGTTGTTTTGAATTAACCGGATATCCTGCCCTACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCA
CGTAGAACGGTGTGTGTCTTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCTGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTA
GCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCAAAGAAGT
GTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACA
AACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGGTACATCTTGCTGAAGCGGTCAACAAAGACCACTATACCAGTCCTCCGCTT
GT