Description :
From Genome Similarity Track
Location :
Scaffold_692:12082- 13087
Transcript NameFunction/comments
g16834.t1hypothetical protein

Sequence
1005 bases(100 bases per row)
GATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAGGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATTTCGTTACACGAC
AGTGGCCACTGCCGCGTGAGCAAGTCAAGGCGATCGACAACTTCTTTGAAAGTCGTCGCAAAGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGC
GCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATACGACGGTACCGGCACAGACGCCGATACCT
CGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTTGATCTGAGAGACGGGTTCTATCAGATGCTCATGCGTGAGAGCGATA
TCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGT
CACGCACTTGTTGCGCTCGGTGCGCGATTTCGCACCGAGCTATTTCGATGATGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATG
CATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACTGAGATACCCGTCC
TTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCGGTAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGCGGCA
GTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTATCGCAGCTCTTGAAGAAAAAAGCTGCATGGGAA
TGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGATGGCCGACCAAGATCGCCCATTCCACGTTG
TGTGT