Description :
From Genome Similarity Track
Location :
Scaffold_13:1207664- 1209464
Sequence
1800 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGA
TGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGT
CGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAA
CAGCGCTGGCGCACCAGTGCCAGGCTCGGGTGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGAC
TGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCAT
CCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGAAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGGC
AGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTACCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGAC
TTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCGGCGTCCTCCGCCTCCTTCCCTGACGAGGCCTTTGCGT
CGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACC
GGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCA
GGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGG
ACGACTCGTTCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCGGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCT
TCCGGTCGACGTGGAGACCCTGCGGCTTGTTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGA
TTTCGACTTTGCGAGTGAAATATGAGTCGCCGGCGTAACTTCGCTCTGATTGGTCGATAAGATCGAATCTCAAATGGGTCGTATACTGTAACGGGGTTAC
ATGAAATAGTGACCCTGTCACTATTCCGGGGTGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTGTATG
ACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGT
CCCCTTCAGACCAGGGACACGTGAAGGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACATATACAGA