Description :
From Genome Similarity Track
Location :
Scaffold_234:12076- 17162
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_234-snap-gene-0.27Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_234-snap-gene-0.26Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_234-snap-gene-0.20Protein phosphatase PP2A regulatory subunit B

Sequence
5086 bases(100 bases per row)
GACACAGCACGAAGTAGAGAAGAACGAATTCCATATTCAGAGCTGGAAACGGCAGGATCGGCGTGGCTTTCTGCTTTTGCTTGCTAATGCTCTTGGGGGT
TACGTCGATCTTGCTCTTCGCGCTCATGGAGCGCTTACTGTCCTGGAAGCCGAACGTGCGGAACGCGTTGAGAAAATCGTACACGGTCGGTTGCCACTCC
ATGCGCAACGTTGCCATCTTTGAGCCCAGGAGCACGCGATAGTCCTCATTCGGGTAGCAGAACGCCGCACTCGGTAGTCCGGCCTGGAATTCCTGTGTAA
GGCAATAACAAAGTCAAGTTAGTGGAGTTGGTATATCGCGGCTTATGATATTGTGTTTGCGTACTGCGGTGGAGATGTGAGTTGGGCGGATAGCCATGAA
TAAATTACTAAGACAGCCGCGCACGATATGGCTGTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAAAGCCGCAATCAACAGTACGGCACATAAACGT
TAGCATTGATCCATTTCGCATGCTCACTGAATAATTCGCATTCAACTCACTTGTACTGAAGAGCCATGCGCCAATCTTCGCCGGGAGCACTGGTCCATTG
GCGTCACTCGTCTTTGCGTCCTTGGCCAAGACGCAGCGCAGAAGAATCGCTTTGCTCCAGAGCAACGCGCCGATCTCGTTCACGTCACTCGACTCCATAG
CTTTGTACACGAGCTTCAAATCGCTGCTGAGCTCCGCGGGTGTGGCCTCATACCGACGGTACGGGAGCGGCTCCGTGATCGGTGAGAAGACGTAGCCGAA
ACGCTCCTGGTTCTTCGAGAGCTCGTCCGTGAAGAGGTGGTTGTCGGCCGAGAGGCTCGTCATGTTGCTCTCCATGGCGTTCATGAGCTTGCCGAGCGGC
GACGCGCCGTCGAACGCCGGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACGTGTCGCACTCGTCGCGCAGCTTCTGCAGCTTGCGCTCGCGCGC
CTGCTTCTTGCGCTTCTCCTCCAGGTCGTTGTCCAGCAGCGCATCCAGACTCATAAACTCGTCCAGAATCGCGGTCTTGGCCGGAGCGCCGCGCTTGCGT
TTCCTATAGCGTGTGTAGGGAGGTGCGTATACATACATATGAGCTCTACATATCATGAAAGCTATTCGCTAAACAGAAAAACATATAGCACAAGCAAAGT
AGAAAAAGCACTCAAACGTACGAGTTGACGCGTCGCTTGTCGTCGTCCACCTTCGCCAAGAGTGCTTCGGCATCAGCATCACCATCGTCCGAGTCGCTAC
GCCTGTACACACACAAAGCGCAAGAAATGAGCACTTGTTCTCCATAGTAAGCGCCATGGTGGCGCAATACCATCACGAGAGCATTACACTGCGGCCTTCT
TCTTGCTGACAGGTTTTTTGGTGGTGCTGGCGCTTGTGCGCGTGGACATCGCCGCCGCACTAGCGCTGCTGCTGCTGATACTCGTGCCCGCCTTGTTGAT
CGCGCGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGTCGTGGCCATTTTCAAATTCCTAATTGTGTGTGTGTGTGCATGTGTTG
TGATGGACAGGCAATGGAAGCGGGTTCGCGGGTCTAAGTAAAATCCGGGTTTTGTCACTCCAACCCGGCTCGCAAATAAATAGTACTGTATGTAGTTTTC
TTATATGTCACAACAGGTTATTACCCACTTTGGGAGTGGGTAATACCCAAATGGCCTCGCAGATCACGAACGGAGTTGGTTACGATTGTTGTAGCAGTCC
CCTCTTTTATGTGCACGTATCCAAGCGAGTTGTGGCTTTCGTTGTTCGTTGAGTTGCTCCCTACAGCAAAAGCGAACACCTGGTAGCAACATGTTTCTTT
CCACGAAGCACGTTTTCTATTTTTTTTCTCTCCATTTGCTTTCTGCCCCCTCTGCTGCAGTTGCGTGCAAGACGCATGAAGATGCAGCTGAGACTTTGCA
TCAGTGCCATTAATTACTTGCTCACTGTTTGAGCAAGTAGTCTGTTATTTGTTTCTTTTGCATACTAGATGAAAAGTTCCAAGTCAATGTGGACCTCCAG
ACAACTCTTTCCCTTTTCTATGTAGGATCTAGATAATGGATCTTTACTTGGCTTTTCATAGAATGTCCTGTTTTTTGTGTCCTAGTTTTGTGGGCTGCAA
ATCAACTCAGGTTGTAGATTTTGATGCTTCGATATTTGCCTTTCTCAACATTCTATTGGCCAATATTCATCAATTCTAGCCAATGATCCCACAAAGCGCA
AAGGTTCCATTTAAAAAGGTAGGCACTTCTCTTGATTGCGATGGTGTTAGCATGGCTGTACACACAACACTAACCCCCTATTCGCGATCCTGAGGGTACC
CCTGCAGTTCGGTGGTTCTCTTGCTGCTGTCGGGTGCGCGCGGTTGTGTGCAGCAGATCAGACTGAGCAGCACGCGCTAGTGGCTCCCAAGCAAGAGCAG
TAAGAGCAGCAACACACAACGCACGCTTGCAGCAAAACAAAACAGCAACGAGCGCGCCCCCCAGAAATAAACTCGTAAAAAAAACAGAAACGGCTCGCAG
AGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCGCAATCGCAGGATTTTAAGCAGGACGCGCATCCATTCGTTCGGCATTTATCTGCAAAC
ACAGCCGCCGCGACATCCGCCACCGATTGTCTACGAGCGAGGTGTGCAGTGGAGTTACGCTCTGTGCTTGAGTGGTGTGATCTTTAAACGGCGCACATTC
GGCAAACAACAGCACAGCAAGCAAGCGAGAACAATCATTCCTGCGCCAACACTTGCATGACGCTGTCGAACCAAGTGGCAGGGTACCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGGGGGTCAAGCGCGCGCACCAACCAGCGGCGAGCATGGCGACGGCAGCAGAGACCACGAACNNNNNNNNNNCGCA
CGCGCAGTCTCGTTGAAGGCAAGTGTTTGCATGTTTCTAGTGTCGACAAGTTGCCTCATGTGCGAAACTCTCACATGCGCAATTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNATTTTGCTTGCTTGCATATATATATATTTTTCTTCTACGAAAACGAAATGCAGCCGAAGTGATCTCCGCAATCGAGTATGACCGAT
CGGGCGATTTCCTCGCCACAGGCAACAAGGGCGGCCGCCTCACCATCTACGCGCGCANNNNNNNNNNTACGCTTTATCTGCCCATGTTGGCATGCGTTGC
ACACATTTGCCAAATCTTGTCGCCAGGAAAGTGTAACATAACCATGTTGTCCTATATGTGCTGCGTGTGCCCTCTAGGACAAGGCGTCCATGTTCGGCTC
GAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCAGAGCCACACAGCTGAGTTTGACTACCTCAAGAGCCTCGAGATCGAGGAGAAGATCAACCAGATCCGCTGGGGTCGCGCGAGCAACA
ACGCGCAGTACCTGCTCTCGACCAACGACAAGACCATCAAGCTCTGGAAGGTCTGCGAGCGCAACGTGCGTGAGGTCACGCAGTACAACGCGCAGGCACT
AGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGCCAACGCGCACACGTACCACATCAACTCGATCGCGCTCAACTCGGACGGCGAGACGTTCATGTCAGCCGACGACCTACGCGTCA
ACCTCTGGAGCCTNNNNNNNNNNGGACCAGAGCTTCAGTGCGTCCTTGCGCTCTGTATTTGCATAGTGGTCTTTTGATCGTGGGCGACTTACGGTGGCGG
TTCTTGTGTTTTGCTCGCGTAGACATTGTGGACATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTCACGGAGGTGATCACAGCCGCGGACTTCC
ACCCGTCTCACTGCAATATCATGATGTACAGCACGAGCCGCGGCGCGATCAAACTCGGCGATATGCGGCAGGCTGCGCTCTGCGACTCGTACTGCAAAGG
TAAGAAGACTCTGGTGCGCTCGCCCTTGAATGAAACTCGAGCACCTGACGCACACACTCTTTTTTATTCACGATGTCACAGTCTACGAAGAGCAGGAAGA
CCCCGAGGCCCGCAGTTTCTTCTCCGAGATCATCGCGTCGATCTCCGACATCAAGTTCTCGCCCGACGGCCGGTACATCATCGCGCGCGATTTCCTCACG
CTCAAGATCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCAAAACCTGTGCAGACCATCAATGTGCGAAATTGGAAAGCTCCCTT
ACCAGGTTGCATGTCTCCTCTGGACTCTGGACTAACGCCGTGTTGACTTTATCCTTTTAGATCNNNNNNNNNNCACGAGCATCTGCGTCCGCGTCTGGGC
GATCTGTACGAGAGCGACTGCATCTTCGACAAGTTTGAGTGCGCCGTGAGCGGCGACGGCAACAATTTCATCACGGGCTCGTACAACAGCGAACTCCATA
TTTATGACCGCTACGGCCGCAGCGACATCTGTATGTCGCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTCACGTGACGCCGCAGGCGGAAAGCACCGACGCGCTCGACTTTTCGAGGAAAGTGCTGCAGACCAGTTGG
CACCCGACGAAAAACGAAGTCGCCGTCTCCATTCGCAACAATCTCTACGTCTACAGCACGTGATGGGAGCCCGAACAGGAAAATCGCAGGTTTATACAAA
GCATCAAGTGGAAATGTACGCGCTGCTATGAAATGAAAACAAGGCAAGAAAGCGATAATTCATGCAACACGAGCTCAGGAAAAGAA