Description :
From Genome Similarity Track
Location :
Scaffold_15:120747- 125920
Transcript NameFunction/comments
g3104.t1hypothetical protein
g3105.t1KUF93023.1 Multidrug resistance protein ABC superfamily [Phytophthora nicotianae

Sequence
5173 bases(100 bases per row)
GCAATAACTATTATCAAGGCATGACATCTAGGCAGTATTATTCGTCGCCGATGGGGTGAATAGGAAAGCGTGTAAAGTTTCTGGGATCAAAGTTTGAGCG
GAACAACAGCCTCGAGTGCTGGTACAGGCGTTCTCGACAATGGACACGAGAAGTTCATCTAGGAACTTGGTGAGCTTGTGTGCGACGCGCTCTTTGCCGA
ACAGTGTACAAAATATACCGCTAGGATCAACTCCGCTAATTACCAGGTCCAAAACGGCTTGGCAGAACTTGCAGTACTGCCGGTGGTGCGCCAAGAACAT
AGTTCGGTACAGTTTGTGGCGTAGGTCGGCGAATTCTTCCAGAGTTCTTTCAATTCGGACTGCTGGGGTCTGCAGACACGATTCTTCGGGTCCCACGACT
GCGTCAATACTGATAGCTGATACACTTGCAGTCGAATTGGTCGCGGTCGTCGGCCGGCAGTGCAGAGAATCGGTGAACACCTCGATAGCGTAGCGTGCTT
CACTGCGGTCCATGGAACAGGACACTCGAATTGCACTGACGCTCTTGAGATCCAGCAAAGCGTTCCGTCGAGCCGAGATAAAGGCAGGTTCTTGCACCGC
CGTCCCGAACGAAACACTACGTTTCTCCGATAGGTTGGGCAGCATGGTGGCTGGCTGCAAGTGTGAGGCGTACTTGTAGAGTTTGATAGTGCCTGGCAAC
GAACATCGATGCTGAATATTGGGACGACCTCATCCAACGCCGCTGATTTCCTGGTAATCAACCAACTTTCGCCAGCACTTCCAATCAACTTGTGCAGTTC
CGTTTCAGTAATCGCTCGCGAAGTCTATCACACAAAAACTCAAGTTTATGTGCTCGGTTGAGGCTCGACCAAGCACCAAAGCGGATTCGAGCAGGACGGC
ATCTGTGTCATCTGTGTCCCCGGGCTTACGAGTAGACGTCGCCTGCCACACTGCCACAAGGATACCAGAGTCAAGCGGCTCACCGCAACATGGTCACGAA
CTCTCAAGCAGTTCAATCTCCACTACGAAGGCGAATAGACGAAAACAGGATGCCCTCAAGATCCGGGCTGTGAAAGTCATCGATAACGACCACAGACATT
GTGGGAGGTCTGCTGGGCTCGAGTGCTTAGCAGGTCTGAAATTTTTTTTTTCATTTTGCGATTTCAAACTGACGACTCGGCCAGTACAAGAGCTACTTCG
ACCTCGTTGCACAAACGGCTCCAGCACTAGGGACAACGACTCTAACAATCACGATATCGTCGGAGAAGTCACACATTCACCCACACCAGCTTTCTTGTTG
CCAAAGGTGAGCCTAAACTTGCACCGCGGCGACATCGACACGTCTCGATCGTGTCCCAAGAGCTGCCATTTAAGCGAGCTGTACGCGAAAGCAGGGAAAA
TGTGTATCAATCAAACGTGTCATAGTGCTCGTACTCTGCCTATTTCATCGGATCTGTAAACCGTACCGCCGGCGCCCGGTCTCTCCTGGTGTTTCTCCGA
CTTTCTTAAACAGTCTACCCATGAGTTTTAGCTGGATTTTCTCGGTCTTCGCACGGCCCAAAATCTTTTCGTATGCTTGGGGTAACTTTTTGAGTAACGC
CGACATGGCACTCCTCTCGGTTGCCGGGCCGTGCTTGCCGTGCCGTCGTCACTCGATTCTACTTGTCAGAGTTGTATTGATAACGATTTTCTAATGTAAT
TGATCAACCTGCAAGCTGCAAGTATTCCAACCGTGAGAATCACAATTTCATCCGGTTTACTTGGTTACCCTACTCTACATGCAGTTTAATTCGAAAACAG
CCACCCAACGGCTTATGCATAATATTGAGGTTTGTCGTACAAGGCACGTTGCTGCTCGTCGTTGCTGGCAAAGTGCACAGGTGCCCCCCACACCCCGCTT
TGATTCACGCTTGCGGATCGCATCGACCCTGTAGATAGCCGAAGACCGATCGGGCCCCACATGCTGGCACTATTGAAACCCATAGTCGTCACCTCCTTCT
CCGCACTGACCAGCCAGCCCTGTTGGTTGTCTTCGTAACTCGGCGCTTTGCTCTCTACGGACGCTTCAGCCTCTTCCTCAAAGAAAGCCTCAGGCGACGC
CGAGAAGTCAAAGGCATTGAAGCCAATGTGCATCTCGGTGCCCGCAGAAACCGGCCAGTTGCCGTCATCGAACCCGGACCGATTTTGCTTCTGCCTCCAC
TTGGCTGAGACTTTCCGTGTGCGACCCTCGTCCGCATTCAAACTCTCGACTTGTGACGTAGTGATGGAGCCGTACTGACTCCCACGACACATTCGGCGGT
GGCGAGCACGGAATCGCTCGATATCAGCGGATTCTTGGGTCGATTTGGTGCCGCTGGGCGAAATCGAGGGCGGCGAGTGCTGAAACATGGGAGCTGTAGA
TTGGAGTGCACTGTACTTGCTTCCGTGAGACGCCTTCAATTTGGAAATGGCAAGTGGTGCAGAACGACGAATCTTATCCCAAGATAACCCGTGTTGCAAA
TGCCCCCATGCGGTGCACTGATTGGCGTGCTGCCCCAACACGCGCGGGTTTCTCGGCTAATCAGAGCAACCATCGCCAAAGTGTCGACTTGAACTGCTTC
ATCGCATATTCCTAGAATGGCTGGAGCTCCATGTTCAATATGATGTTGCCACTGAACCGCATCCGACGAGTTCCGTTTGGTGACGCTGGGTGCACATCGG
GCCTGTCCTCTTGCATGCATACTCTTAAGCAGCGCATTGGCTGCATTGATTCCAGCAGTCCAACACTGGTCAATCTGAGCTCTGGCCTTGGTGTAGATTT
GACTGACTTGATAAAGGGATGGTGATACTGTACGCCGCTGTATGCATCTCTTCAAACGCGTTGGCAAGCGTATTTGGACGGCAAACAAGTGATCTAGGCA
ACCAGCAATCTTTTTCCGCATCTTGCCAAATGACGAACTCAGGAGAATAAATTGAAGGGTTGAATGCTTATGAGTTAGACTAGTTTTCTGAGCTTCAACT
TCAAAAGTCCCCTCAGTGGTTGGTGCTCACTGATCAAGCTTATGTCATCTAACGAAACAAATCTTAGTGTCGGAAATGGATCAATGCAACCCGATGTCCC
ATCCAGGAATCTCGAGATATGTCTACCACTGTTTAAAATTCGTCTCAGGTCCACTCACGAGGTTTCGTTCTTCTTCTCGTCCAAATCATTGGATGTGCTT
CGGAATGACCCCTTGAATCAAGAAAACTACTTCCATAACGCCTCTGCGAAACTCCAATCCGTCCTCACGCATCTACTTCAAATGGTTTGCCATCGCCAAA
CAATGTCCGTCGTGTACTCTAAGGTACCCTCCGAGCACTGTCGATCAAGCGTGCCTGCAATGGCTTGGCAAAGCCTCGGTGGTGCTCGTGTTTGGTGCAG
CAATTGTACTGCGCTTCCAGCCTTTGATTGCTGCCGTGGTACTCGCCACGCACTGTTGCTCTGAGCAACAAGACTTATCGATTCACTACAATGAACACTT
TTTATTGAAATAATCTGGGGCTCGATGCACTGCTTTAACCACTGTGGTTGGGCGGTTCTTCTCGAAGCAATAGGTAGCAGGCATGTCCGCCCCTATGGTT
CTTAAGCAACCTGGAAATTAGACTCGCTGGCCGCGAGAATATCGCGTACGGACGCGATTGTGTACTCGACGTCTTCAGACGTCACATGCAGGTTCGTCAC
CGCGCGAATCTCCTCACCTCTCCAGTACCCGCCGAAAACGATACCCTTCTCCTCGGCGACCTTCTTCACGAGCGCGGGTGTGTCCATCTTAAAGTCCGAG
GAAACCTTAAAGAACAGCATGTTGGTGTCCACGCTGTCGGCGTCGATCTCGATGCCTGGAATTGTGGACAGGCCGTGTGCAAGCGCCTTGGCGTTCTCAT
GGTCCTCTGCGAGGCGGTCGAACTGGTGCTCCAGAGCGTAAAGAGCTCCGGCAGCGAGCAGGCCCGACTGGCGCAGACCGCCGCCGAGAGACTTGCGTAG
CCGCTTGGCGTGGTGGATAAACTCCTCCGAACCGGCGAGAATGGAACCGACGGGGGCACCGAGGCCCTTGCTGAGGCAGAAAGACACGGTGTCCGCGCCC
TTCACGAGGTCCTCCAACGCGACGCCCGAGGCGACACTGGCGTTCGCGAGACGCGCGCCGTCCACGTGGAGGCTCAGGTTGTGCTCCTTGCAGAACTGCT
CCACCTCGCGGATGTACGAGAGGGGCAGCACCCGTCCGCCGCAGGTGTTGTGTGTGTTTTCGATCTCCACGAGCGACGTCCGCGGGTAGTGGATGTCGTC
GGCGCGGACGGCGGCTGCCATGTCGCTGAGCTTGATCGTGCCGTCCGGCTGATTGGGGAGCGTCGCCAGACTGACGCCCATGTACGCTGCAAACGCAACC
AGCACGAACCACCAGTTAGCGACCAATTGCCGAATTAAGAGGTGGGAATGAGCACTCACCACTGGCACCAGCGCCCTCGTACGTGAAGATGTGCGACTTG
TTGCCGCAAATGACCTCGTCGCCGCGCTGGCAGTGCGTACCAATGGCGATCAAGTTGGACATGGTGCCACTGAAGAGCCACGGAAAGAGTCGGGCGTGAC
GTTAGCAAACTTCAGATCGAACGTTTCGAACTTCAGAAAGAACCAAGCGGACACGTACGATGGGACGAACATGGCGTCCTGCTTGCCGAGCATGCTGGCG
GCCACCTTCTGGAGCTGCTTGACGGTGGGGTCCAGGCCGTAGACGTCGTCGCCCACCTTGGCGGCCGCGATGGCCTTGCGCATGCCGGGCGTCGGGCACG
TGATGGTGTCCGACATGAAGTTGATGACGGCGTGCTGCAGTTTGGTCATGATCGTGGTGAGCTCGAACTGGTGGATCTGAAAATGGGCCACGTGGGGCAC
TTCGCGCTGACGCAGACCGGATGAATGGACGGACGCCACGACGCACTCACTCGGACCGCTGCAAAGGTTGCAGGGCGATCGCGCTTATGCACAAGTAGTG
AAACCATTAGCATGCAGAGTTGCGCTGGTCGCAGCGACATGACGCCGAAGCAGCAAAATAGACAGTCGACACACGCCTGGAGAGCGCAGACCACAGCTGG
GCGGCAACTTCTCTCTATGTGCAGGTGAAAGTAGCATACAAGCGGCCTCATTGCGAGCACCTCCACAGCGCAG