Description :
From Genome Similarity Track
Location :
contig_60:120707- 130676
Transcript NameFunction/comments
g11157.t1RAW43695.1 hypothetical protein PC110_g176 [Phytophthora cactorum
g11158.t1ETI31160.1 hypothetical protein F443_21873 [Phytophthora parasitica P1569
g11159.t1hypothetical protein
g11160.t1XP_009515964.1 hypothetical protein PHYSODRAFT_322325 [Phytophthora sojae

Sequence
9969 bases(100 bases per row)
GGAGGAATTCTTGCCTCGTTCTCGATTGCCCTGTGCGGCATGTTTGAGCGCCTCCCACCTGACGCAATCGCTGAACCGCAGCTTCGCGAGGTCTTGGATG
CAATTCTCGCTATCCTTGATCATCCATTCGCTCTTGGAGATTTGACCCGAGCGCGCAACGCTGTGGGTTTTGTGCTGCGCTATGGACTCAATGGGTGCCT
CACAGAGCGTCAGCAAGATGTGCTACTAGGTGCATATTTGCAGAAGCTGAAAGATGAGGCTCAGGCAGTTGAACCGAACCACCACAAGATATTGTCTACC
TTGGTGGAGCTGAGTCACATGTTCCATTCGATGGGCGAGGCTTGTGTTAGCCATGCACGCGACGCTAGTGATCTACTCCAAGGTCTTCTTAGTCACGAAA
AGCAAAGTGTTCGCTTCCAAGCTGCTGTTGCGCTGTCTTCGCTTGTCACGGCAATTCCGTATCGGCTAAAGACCGTATTGACAAGCTGTCTTCAGGGTCT
TCGGGATACTGCCGAGTATCTGATGCGTGGTGGCTCGGATTTGGAAGAAATGAGAAATTCAGAGGCTGACAAGACAGACGATGGTCAAGAAGAGGGCAAC
GATGTACAAAGCAAGACCCACTTGTATGCGATTCAAGGTAGATCCGCGGCAATCGCTCATATTCTTCGCGCCATCAAGCTTGATGCTAAGGGAGGGTTAT
CCCAAGCGGCTATGGACGATATCTACTCCATTTCTGAAGAGCTCGTCGAAAGCCAGTTCCTCAGCGAATGCGCTGATAGTATCTGGCTCACTTGCACTCG
TGCAGGTTGGACTTTGGTGGGAAGTCTTGTGGCTATGGACGATAAGCAGTGGATAAAGGCTAATCTGGAAAAGCTCCTGAATCTGTGGCTAAAATCCAGT
GTGATGCACAGTCGCGAATCATCCCTCGAGCTTCTGCGCATTGAAGCTGCTGTGATTGCTCTGAACAGCCTCCTATCCAATTCTCAGGGTATCGCAGTAG
ACCCTGACAACAATGTCTACCTTCTTGCAAGCCACGTGCTGCACGTATATTTGACGGCAACGCAGGACACCCTCAGCCACCCACTTAAACGGCGCGGCCA
AATCGCTCGGTATCGTCTGATGGGGTGGATCGTCAACTGCTTTTCAATGCTTCCACCGATATTCAGCGATTCGTACATCGTACTTTTGGATTTAATTGCT
GAGTTCACAACGGCCCAGGCGCTCACAAACCTCAGGCATTCATCGTTGGTCCCGGCGAAATCAACGTACTTGCTAAGTGTGCTTTCCCCGGAGGATAGCG
CACTCGACATGGTGACCCTCTCGAGGTTGGTGGCGGGGGATAATCCATCACCGCTGTACTCAAGAGAGCTCAATCACGCGCTAGGATTGCAACAACGGGA
AAACGCTTTGACGGATACTGAACTCGAAGTGCAATACCTTGACACGTTTTGGAGATCAATCAGCGAACGAGAAGTTGAGGATGGTGTACGCAGACGAGGA
GTTTGCAGCCCGTTCACGTACGTTCGACTCGTGGATGCAAGTGTGCTTTTGTTTGGTCGACTTTTCCACAGTATCCCAGAAGATCTGCAACTGCGGTGCT
TACAGCACTACGCAGGAGCCTTGACTGATGTCCGAGTTGAGTGTGAAGTCAATGTGTGCGCGTTGCTATTTGCTGTGATTGCTGAAGCGAGGCGTCTCGA
AAAATCTGGTACCGCACCAACTCCAACAGCATCGCTTTCTGCAACGTCGTGGCCTCTTCAAATGCAAACGATGTTGTGTGAAATGATTTCAAGTGAAAAT
GCAGAGGTTCGTCGTGGTGCAGGCGAGGCATTGGGGACGCTGGCACTGCTGCTTGGAGAAGATCATTGCAAGGCGCTCATTATCGAATTGGAGAAACGAT
TGGTGGTGGATAAACTTCCTCAAGGAGCTTCTAACGTCACATACGGCTCCAATGCTGATCTAGATGTTTCTGTTTTATCAGCCGGTGCAGCTTTTGCTCT
AGCATGTATTAAACGAGTGTGTGGTTCACGCATCTCAATCGACACAGGACTCATTTTCCGATTTGCAGGTGAGTGTTCGCAACCGCTGCGCACATGGATC
TTACATTCATGGAGCATTATTCTGGAATCCGTTAATTCAACGGGAGGGGACTACGAGCAGTTTGTGAGCTCGACATTTTCTCTCTTGGAAGCACATGTGC
TGGCAGGCTTTGTCTATTCCAAGGTGAACAAGCGTGGACTACGGTGGCAAATAAGCACAAAAGTAGCGTTGGGGCGGATTATTAACGAGGTGGTAGCGAC
GCTCGGTCCGGAGCTTGGTGGTTCTAGCGATCGTTTGAACGATTTCTACTCTTACTGGATGCTTCTTCGTCAGGATGGCGACGCTCGTGTTGAATTGGAG
TTCTTGAAGTTTCTGGAGCAAGTAGTCGTGTTTGCACCGTCTCGCTTTCAGTCTGCAGATTTAAATTATATTCTGCGTATCGTGTCTGATACCGCTTTAT
TGAGCTCGGCAACCCCAGCATCGCTGGCATCGCAACACTCAGGCTCTCCAATTTTGTCGCCGCCGTCTGGACCTGGACCCTCTTTGGCTACGTTGAGCGC
CTACGGAGATTCCTTCGAGCAGAATGGTCTCGTCAATGTGGGGGTCTTTACAAATGGGTGGAGCCGAAGTATCCTTCAGAATGTTGGTCTGTCTTGCATT
CGCACGCTGGTAGAAAGGGATCCGACATTGATTCGACGTCAAAATCTGTTTTGCCTCCTGTTTTCGGCACTTCACGTGGAGTACAACGAGTTGTTGTGGG
GTTATTTGCCTGGATTGCACGGCATGTGGGATGTGCTCTCTTTCTCTTTTGCTGATTCTACGACCATGCAACGGAATGGAATTGGCGCACTGCAGAGCAC
AGCCCTGGCACTACTTGACGTGGAAGGCAGAGATCACGAAGGTGCCGAACCATGTTTATGGGCTCTGCTGTGTCGTAGCATTGCCATTGGCGAATCCGCA
AGCACATTTGCGGGGGCTGGTGGAGGGGAGCTCATGATGAGCCCAAAGGGAATGAACTCTGGTATTCAGGCAGCTGGAAACTCCGAGGCTGCAGGAGACG
ATGATTTGTCGGAGTGGTCCCCAACGCCAAATCTTGATCTGCCCAAGACTGACGCAAGCTCACTTGCATCTGCTGCAGCTGCCGCCCAAGTGGATACGTG
GCGTGCTACAAAGGCAAGTGTGGGTGAACTCATTGCATTGATGCCCCCCCTTTCTCGTCAAGTACGCCACTTTGCGGTGGAATGTGTATTACGCGTTTTT
GAGTTGATGGTGTCAATTCCACCATTGACGACTGGTGTGTATCAGACTAAGCAACTCCATTTTGATTTGGCTGCGGCTCGCCGGTATTTTTTTGAGGTGC
TCTCTGCTGGAGCTGCGTTGCCAGTGTCCACCATTGGAAATTTCTTGTGCATGTATTTGGACGAGTTTGTCACTCTCGCTTGCCACGTGACGACGACGTC
AGCCGAAGGAGACGAGCTTCTTATGTTCCAATGTGTTGGTGCTCGTTTGCTTAATGTGCTGGTCAAGAACTTTGCCTCTGCACGTGATCCAGAAGTTACC
GCTGGGGATGCTTATTTGTTAGACCCGTACCGCGCTCAGCTTTCGTCTGCTACCCGCCATGCTCTCAAACAAGTGCAAGTCGAATCTTCGTTATCGGCCT
CTGATAAAGAGAAGGATGAGGAACGATATTTCTACGCTCCGCTCCTTCTGGAGGCTCATGGTGTCGCTGGAGCCTGCGTCTCAGCTCATCTTATTCAAGA
TAAGGTGGGGTTGGGACGTATCCTGAGAGCAGTGGTGATGCCGGACTATGGCCACGCGCATTTCATTGGAGACGAACTCACGCGCATCTCCCTTTCGCTT
GCAAACCTGGCATCTGTGGGAGAATTGCTAACGTCAAGTATCACTGAGGCGATCGCTAATAAGGATGCGCGCGATGACGAACGCCGAGCTATCGCAACTT
CTCCACTAGTGAAAGCGATGACTAATGGCTTATCGGGGACCACCGAGTACTTGTTTAAGTGCTGGATGGATACAACATTCGCGTACGGTGTCGTGATGCA
AGGTTGTCCACAGTGGGCGCAGTTGGGTGCAACTTCAAGCGTGTCGTTACTTTCTGACGAGGTGATGGTTATGCCAGCCTTACAAATACCGCTACCGCCC
GTGGGGTCTGCTGCGAGTGCTCCGGCGGCTGCGTCAATGGCTTCGAAATCACTACGCACACTATACAAGCGGTACTGGCCAAAGATTGTCAATGCGATGG
CAGCATTGGAAGTTTACATGCCAAACTCGGTGACCCTGGTCAACACAATTGATGGAAGCATTCCTAAATGGTCATCGGTGCTGTTGTCATGTGCGATTTT
CCATGTCAACACGAACGCTCGCGATCGAATGGAGGACGATACGGAGCTACCGGCCGTTCTCCGCAGCATTCCGTTGCTACTGAGAGCTTCGGCTGAAAAT
CCGCTCAAAAAAAGTGGCCCTTCATCTAATAGTTTCCCGGTGCTTCTAACGACTGCACTGAATACTTTGATGCTCGCCAGTAAACGGTGCGCTGGCCCAG
CTCAGATCGAGGCCCTGGAGGCTATTTTCTCGTGTCTATCGCGTGAAAATCTAGCATTTGCTCGGGAAATGTGCCGCTCGGCTGAGGATGGCGAGCATCT
CAGTGCTGTACTTTTCGATGTCGTGGCGCAAGCGGGGTTGTGTCCTACCGAGGTGGTTTGCCAGCTTTGTGACGCAACCGAGCAAACTCGGCATGCTCGA
GCGGTGAGTATCGGGAGCAAAGGTACAAAATCCCGCCGTAGTTCTGTTGCAAGTAGCGAGGATGCCAAGCACATGGTGGAGGTTGTGCAGCTCGCTACCA
CTGGTATTGTGCTGCTGCATACGACAGAAGAAGCTCGAAGCGGGGTGGTGCGCTCGGTAGCCTTGGTGCAGCAGGCCATTTGCTCTGTTGCTGGTGGGTA
CCATTCTCCTTCGGTAAAGGGAGCTGTGGCAAAGCTATGTCGCGCTTCCACTGAGTCAGTGCTTGCGCTGGCACGCACGCTTGAAGCAAATAACGACTCC
AGCGACGAGGTGCTGACCGGTATCAAGTCAACCATAAGCAGTTCCTTCGAGTTCCTCGCCGAGTGGCTTAAGGAAGACATTCGTAGTGCCCCAGAGTTTG
CTATGCAAATTGCGGCGAACTATGTTGCGAACTTTCCGGTGTGTCTCCAGGGTGATGCAGGGCGCTTCCACGCTGATGTTGCAGAAACAACCTCAGCAAT
ATTGGAGCTCGCATCCGCGAAGGAAGATGATGAAGCTACGAATCAGCAACATGCCTCATATAATGCAGAGCTGTTGCGAGGCTTGCATGCAGTCGTGAAA
AAGCTCGTCGATGTGCACCAGAACTCCATTGCGAATCGGTATCTGGTGTCGCTCGGTCCTTCTCTTGTGGAGATTGTCGGTACAGCAAACGGCTACCCAG
GGACAGCCGCGGAACTTGCTGAGCTGGATGAGGCAGAGGGGCTTCTTCGTCTGCTAACGTCGCAGCTAAACGACCACCATGGGGCCGCGTTTGTACACAT
GCTACTTCCTAGATTGGCAGAGGTGCTCAATCATCAAGCTCCATCTGCGACTGAAAATGTGATTCATGCGCAAGTCCCCAGCATCCTGGCACGGCTGCTT
CTATGTTTTGCACAGACTCACGCAACAGCGTTCAAGGAAGCGGTGGCAGCCATGGTGCCTACATTGCGAGGCGTCCTAGAGAATGCGCTACGACTTGCTC
TCACAGGCTCGGCGCCAGCCACGGGGTCACTCCAGTCATCGGCCCCTGCCGCTACCAAACTTGACCTGAGTCGGTTCGGTTAAACAATGACTCGATCCAG
ATCAAGAATGTTTCAATGTTTCAATGGATCCAAAAACAACAAATATATGTCCGTAGGTTAGTGCTACGTGCGCTAAGGAGCACCTTGAGTGCTCAGTGTG
GTATGCATGGGGCAGTCTCTCAAGTCGTCGAAGTTTCGTTGGTGGTCTTCGACATGACGCGATTAGATGTTCGTCGTATACACTCAAAGTGTCATCTCCG
GACGCGAAGTCGTTGCAACGTCTTGGACTGCCAGTAGCTCCAGCAGGCTGAACAACACTGTGTGCACGAGGTCCATGCTGTACAACTGATAAAGAACACA
AACTATCAAGTTAGCCCACGCAATTCAGCCTCCTCAGCTCATGCTAACCCCACCTCCACGCCTCCGTCCAGGTCAACAGCCAATTCTTGCATTTCAACTC
GCTCGATCTCGTAGGTAGACAAGTCAAAAGGCAGCGCGTCAACGTACAGGCGCTCCGTCAACTCAATGAGCTCTAAAATGAACCATACCAGCACATACCA
ACATAAGTTCTTGCACACAATGCAGCTACGCGACCTCGCGTACCTGGAACATACGCGGACGGGCGATTGCCTCCCGGTCCGTCTTTAGTCTGCTCAAACA
GTCGACGCAGCGTCGCCCAGGGCACCGTGAGTGTGTACGACCGCACGATGTCCTCTTTCTTTGTAGCACGGTACTTGAGCAGCAGCGGCGCTCGCGGCGG
TTCCTGCGTCGCCATCGAACTATGCTCTCCTTCCTCTTCTATCTGGTTGTTCGTCTCCTGCTGGATCCTCTTCGGTCTCGGCTTCTGAGCTAGCAAACTA
GCGACCACCCAGTTCCGCGCCAAGCGCTTCAAGTTGAGCTGCTGGATGTGCACCACATGAGTGCTCACGACGCATTGGAAGCGCCGCTGCAGCCAGGAGC
AAACCCAGCGCAACAGTTCTTCGTGTCCTCGTAGCAGGAGCACCTGCTGTCTCTCGCGCCCTTTGCGCGGCGCTCGTTGCTCCTCCTCCTTGGGGAAGTA
GAGCACAAAGCCGCCCGTGCGTTCGGGCGCGTTGGACTCCGCTGCTTTACTTGTCTTGGTGGCTCTGCTGCGGCGTCGGTCGCGCTCCTCTCGGATCTGG
AAGGCCACGAACGTGTCCGTATTGCGGATGCTCACGCTGTAGCCGAGCTGTTGGCCGCACGCCCGCAGTGCCGCGGCGCGCAGCGTCTTGACTAGGTCGT
GCGCGTAGTCACTGAGCTGCTCGCGCTGGAAGTGGAAGAGCGGCGATGCGCAGTGGAAGACCCAGCGGCGGTCCAGCAGCACTTGCTCCATGCTCACGCG
CTCGCGTTCGCGGCGCGCTGCGGCCTGGCGGGGCGTCTCTTCCTGCGGTGCTTCGTCGCCGTCCTCGGGCACGCGCGTGTACTGCGACGGGCGCATGGGT
GAGCTGTAGGCTGCGCGGAGCTTCTGCTGCTGCTGGGGCGTGACGCGCGGCTCTGGGCGCGAGTTGTCCATGGCGTCGTCCTGACTAATGGGGCAGCAGA
GCGTCATGGTGTCGTAACGGTTTATGAAGGACGCGGTGATTGGGGTAAAATCGATTAGTAGAATTTTTGATAGTGGACGGCGTCGGTCAAGCTGCTGACG
TCAGTGGAGAACCACCTAGCGTCTGTGACTTAATTGCTCCGGAGGAACGCAGTGGACTGGACTAGACACGCGGTGGCTTACCCACCCGCCAGGAGGAGGA
AGATGAGGATCACTACCAGCACCAGGATCGTGATGTACAGCTTGGTGTTGTTGCTTTGCTTGGCCACCTGGTCAAAGAGCGTGTCAACACGACTGCAACG
TAACATCAAGCAGGATTCGTCAGCGACGTACCCGTGCGGCGCGCGCGGACTCCGACTCGAGGCCGTCCGTGACGCGGGACACATCGTCGTCCATCTCGTT
CAGCAATCGCACGTGCAGATCCGTCTCGTCCTTCACCGTGAGACTGTAGTTGTGCAGGTTGGACACGCCCTGGCCGATCAAGTCGAGCTGCTGGTCCTGG
TCCTTCATGATCTGGTTCTGCATGCTCAGCAGCCTCGCCGGCGCGTCGGCCGCCCCAGGACTGCAGCCAAAGAGAGAGAGAGAGAGATGAACACCAAAGA
CTGCCAACTAGGAGTTCTACAGGCCGCACCTCACTGCGGCGCGTGAGGTCTTGCGGCTGTTGTACATCTCCAGGTCCTCCTTCTGGTCCTGCGCTAACTG
GCCCAGCAGTCGCTCCCGCCGCTCGATCTCCTGCTGCGTCCTGCCCAGCAGCAACAGCACAACACCCAAATAGTGAGCCTTTATCCAGGAAGTGATGCCA
ATCCGACGTAGATTTTTTAGCGTACACGGAGGTGCTGGACGAGCGCTTGAGTTGGTCGAAGTCCCGTTTGAGACGCGAGACGCTCTGCTGCAACGCGAAG
ACGCTGGTGCCGATGGTCCCCGCATTTCCCGCGCGGATTTTGCTGGACAGCACCTGCTCCTGACCGCGCGCGCTCTCCAGCCGGTCCAGCCACGACGCCC
ACGCCGTCGCGCTCATAGTCGGAAGAAGGCTCGGAATCTGAGAAATCTTTCTAGCTTGTAGAGCGACCGTAAAGTCGAGATGTCTTTGAACAGGTTTCGC
ATTTAAGAGCATTGATGCGAGCCCACCCATTATTCAAGAGAGGCTCAGCAGACGACGACCATGAGCCAGCGGGAGTTCGAGCGCAAGATGGAGGAGCACA
TCGAGGAGATGCGCGTGACGCAGACGATCGCGTACTTCAGCCGCACAGTGGAGCTGTGCTTCTCGGACTGTGTGCACGCCTTCCGCAGCAAGAAGCTGGA
CGACAAGGAGACGTCCTGCGTCAACAACTGCGCCGAGAAGTTCCTGCGCCACACCATGCGCTCGTCCGTGCGTCTGCAGGAGAGCTACGCCGAGATCATG
GAGCAGCAGCAGGAGCAGCAGAAGTAGAGCCAGAAAATCGCGGGCAGACCAGGCACGCGTTGATGCAGCTTTACTAAGACACCTAATCGAGACTCGCGCA
ACGGCGCTTCAAGCCCGCCTTTGCATTGAGTTTTGAGATCGCTGTTAAAGGGCATGTAACACTACCGCAGCTATGAAGCAGAAGTGGGCAAGGTGCTGTT
GTGCCGACTGCGTACACCTTGCTGCTGCTGGTAGTATAGAGCACTAAAACCAAAATTATACATTTTATGCAAACTCCAGACCCAATTCGTGGTCAAAATC
CCCAAAAAATGGCGTCGTCGTCCCCAAGCGACAAGCTGCGAACCTCGTCGGATGACGGTGACGCGACCGCGGCCCGGGGCTTCTCGAAGCGCGGCGACGG
CTTCTCGGTGCAGGAGACGGAGGGCTTGCTGCAGGAGGTGCGCGACCGCTGGCAGGAGGGCTGGGAGGTGATCACCGAGGTGCACAACGCACAGTTCCCC
GGCCACAAGCGCACGTCCGGATCGCTCAAGCGCAAATTCTCCAAGCTGTACCGCATGAAGGTGGACGGGGGCACCAAGGAGAAGCACGCACGTGCCGCGG
CCCTGGCCAAGAAAGTACGCGAGGAGATGCGCGCCCAGCGGCGGGGCCTGGGCGTGCGCGGACTCAGCGAGGACCTCCCAGGGGGGACCGATGGCGTCCA
GGACGTCCACGAGGAGCTCAGCGAAGTGGAGATAATCACGGCCCAGTCCACGCAGGGGCAGGCGCTAGTGGATGCTGCCACGGAGCACGATCTGGGGCAG
TTGACGCAGGGGACGGGGCTGCGCGACGATGCGTGGCAGGCAGCTATTAACCGCTGGCCCATTGCTGGAGAGCGACTGCGCACCTTGCGGACTCAGATCG
CGAGCAATGAGCCGGCATCGAGTCAGGACCTGGTGCAGACTGTGCTGTTGGTGCTGCTGGAGTCGCAGCACCAACGGGACTTGGAGCGGGAACAGGAGCG
CGAGGATCGTCGGTTGGAAAAGCAGCGCTGGCTGGAAGAAATACGCGAGCAGCACCGCCGACACGAGCAGGAGCGTGTGGAGGATCGCCGCAGGAACGAA
CAGTTCATGCAGGTCATGACGACGGTCATGGCACAGCTTGCGCAACAGCAGCGAGGCGGCTTGAACTGA