Description :
From Genome Similarity Track
Location :
Scaffold_58:120696- 125584
Transcript NameFunction/comments
Hyaar_Emoy2807001hypothetical protein

Sequence
4888 bases(100 bases per row)
CTAAGTCTTCCTCTGACTTAAGGATCTGTATAGCTCCGCTACACTTGGTAGCACTCGTAGTCAATCTACGCCTGAGTCTTTAAAGACTGATCCTCTGTGA
GGATGGAAAACCCCACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGAGTTCCTTGTATCGCA
AGGCCTGGAGGTGCTGATCGCACGTGTTGAGGTCTTCTTGCAGTATGGAGTGTCCCTTCTAGGGCAGGTTCAAGACCAAATGGCATCGGCTATGCCTACA
CGCTATGTGTCTGTTCCAGACGAAGAGGCTAGGTCTCGTCCACTTAGAGTGGAAGTTAAAACTACTCAGGAAAGGAGGGTGAAAACTTCATCCTCTGGAT
CGGTGAGATTGAGATGGCCATGAGATCAGGTCTGATCAAGCTTGACCATCAAAAGGTCTCGCTGGCAATCTTAAAGCTCGATGGACGAGCTAGAGAATGG
GCCTCGACGTGTAGCACGTCGGTCGACTAAGCGCTTCCCACATGGAAGTCGCTTAAGTCACAATTGGTATAGGTGTTTTCACCACCTAACCAGACTTACC
GCGTGCGTTCACGTTTTTTATCAACCCGTCAGGGTAAGAATGAGTTAACGGACTATGTCCAAGAGCTGAGAACTCTCATGGCTGCTATGCAGTCTGACCC
TCTGCCTGAGGCAGTCCATGTGATTATATTCATGGAGGGTCTCCGTACTGGCATTGCTGGAACCGAAGTCTTTCGGGTTCACCCTCTACATTCGAGGAGG
CTGTGAGAATTGCTCTTAATGCTGAGCATAACTTCAAGTCGGCCAGACTTGGCTGGAATGGGTACAACCCTAGCTCTGCGAGAGCAAACTCCACGAGTAC
TCCGGCCGTTAATAGGCCGGAACCGATGGATCTCAGCTATGCTGAAGATGGAGGTGAAGTTGAACTTCAAGCTGCTGATCAGAAACGTGTTGTACGACGG
TGTTATACGTGCGGAAGCAATAAACACTTGCTGCCTGGTTGCCCTTTGCGTAGACAGCGCCAGGCTACGAGTCAACACTCTACCCCGATCCAGAAGTCTG
GCATGGCACGGGGAAATGCCGACACCCAGTAGGCGCGGGGCGCCCTACTGGGGAAGAATTAGGTTCTGTAACACCTTTAGGAGGTAAAGTTGAATAGGGC
TTATCCCCAAAGAGTTCCATACCTACTGGTATGGAGCGTGGATACAAGTCTGGCTTGTTGGTCGCTGAGACGAAAGCTAAAGGCTTTGAAAAGCCTTGGT
CAATTTTAATCGATTCTGGGGCGTCTTGCAATTATGCTCGACGTCGTTCCCTTAAGGGAAGTCAGCGTTATGCTGAAACGCTTACAGCGCATGATGTTGA
TTCAATCACGGTTCGTTTAGCGACTGGAAGTCGCGTCACTGTACCTAGAGTTCAGTTGAACTTAGGTATAAAGTTTTTGGACTTTGATAGCATCGAACGC
TGTCTTGTCCTTGATTTGGACCCGACATATGATCTCATCCTAGGAATGGCTTGGCTTGAACGCCATGAGCCATGGATTTATTGGAGGTCGAAGACCATAG
GCGCTACGCGCAATGTTTCTAGCGAAGTTTTGGAGAGTCATGAACCCACCTTTGGTAGGAAACAAAGCACTATTGGCGCGAGCCTTTGACAGAAGATGTC
AATGTGCTGGACATTGGAATGTCTGAGTTAACTAACTCCAATGCTGACAACATGAATTCCGAGCGTAGCTCGTTGAATATTAGCGATACGGCACGTACTC
CGTTGAGTGTTACTCGTTGTGATAACGATTCACTGCATGCTGAAAGCATGGTTGGCCTAGGGCCGAGTTATCAAGGATGTGATTCCTTTGATGTGTGTGT
GTGGTGGCACGTGAAAATGCACCGAGTGCGGTCGGCCGTGAAGGCACCACACTTAATGTCGGTAATGACATTGTTGGAGAAACGCCATTAAGTTCAAGGC
TAGGCCCGTATAATGTAAGTGGAGTGGCACTTTTAAATCCACTGGTTGAAGTGTTTGAGTTACGTAACACTTCACCGGATGTCGATCAAGACATCAGCTC
TCGTATAGAGTATACTAATACTAGTAGTAACCACGGGGACACTATTGCCCCGACCCCAAAGGGGTGTAAGGTCTCATCGAAGAGACGACCGGGACGTCAG
GTGGCAACTGTTAAGCGCCAGGCGTCCGTGCAGTCACATAGTGACAATAGTGATACACTATATACACTGTCAACGGAGTGACTGGCCAGGTGGAGGACAA
TGTTAGCCTGGAAACCCTCCATCTTTGGATGGTCTTTGTGAGCTAGACGAAATGTCTGATAGCGAGTTTAGCCAGGCCTTGAAAGCAGGAGATTTATCCG
AATTAGTGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCTCATTAATGGATGAGTCGTTCCTAGAGGATACCAAGGCGGCACTCAGTGCCCGGAGTGG
ATCTTCGATCCTTAAAGATCCTTTGGATCCATTCTATCCTTTGGTAAAGGAATTTCAAGATGTGGTGTGTCAAAACCCACCATCTGTATTACCTCTCGAT
AGAGGTGTACGTCATGAAATTGACCTAGTTCCGGGAACTAAATACTGCGTAACACGACAGTGGCCTTTACCTAAGTAACAGTGTGACGTCATTGACGATT
TGTTTCGTGCAAAGCACGCGGCTGGAATGGTGCGTGAGAGTAAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAACCTAATGGTAAGTGGCGTATT
GTGCACGCTTATAATAAGCTTAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGAATGCTCTTCAGAACAATATGGTGGGATGTACATTGT
ACAGTGCGCTCGAATTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGA
GTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCCCGGCTACTTTTGATCGTCTGGTGACGCAACTATTCAGACCTCATAGAGGCTATGCACAAACGTAT
TTTAATGACATATTTGTCCATAGTCGTGCAACGAACGGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCAGTGCTCGAGTGCATGCGCACGA
ATAAATTGTATGCCAATGCATCTAAGTGCATCTTTGGTGCATAAGAGATTCTCTTTCTGGGGTGCTTCATTGGAAGCGAGGCCTTCGAGCGGACCCCGCT
AAGGTAAGGGCCATAGTCAATTGGCCGGTTCCAAAGAACAAAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTATAGTGCGAATT
ACAGATATGGCTCGGCCATTATCCAATCTCCTTAAGAAGGGTGTAGATTGGTATCGGGGTAACACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAATC
TCCTTCATGCGCCAATACTGGCTTTGCTCGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAAC
AGATGTCGATGGACGCGAAAGAGTCATTGCATTCGGATCTCGACAGATCAAAGCTGCTGAAAAGAACCGTCCATTTCATGACAAAGAGCTACTTGCTATG
AAGTACGCTCTGGTCAAATTCAGAGTACATCTGCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTTCGCACTGCGACTCGCCGCATCT
CTCTCAGAGAATGGATCGTTGGCTTTTATTCTTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGAAAAATCCTTTGGCTGATGCGCTATCG
CGCCGACCTGACTATGATCTTGCTCACGTCACTACGCTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTT
TGCTACGTGCTCTTGGAAGCGAGGAGTTTAAAAACTCGGACATAGAATTGTCGGCACATTTATGTGCGAGGCTACATCGATATTCTATCGATAATGGTCT
GTTGTGCTATCGCACAGATATTGAGAATATCCCTCGTATCACTGTCCCTCATGATGAAGATTTGAAGTATCGAATCCTCTATGAGGCACACGATACCGCT
TTAGGTGGTCATCTCAGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGTGGCCCAAACTATACAAGTGAGTGAGCAACTATGTGTGTACGTG
TGAAACGTGTCAACAGGTGAAACCCTCCGCACATGCGGCGGCGCCGCTGGCTAGTCTGCCTATACCCACTGGGTGTTGAGAGTCCATGAGTATGGACTTT
GTGTTTGGCCTACCGAAAAATTCGGAAGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGCGGCAGTGCCAGACTCTA
TTGATGCCAAAGGTACAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAACATGGTTTGCCAGTGGCAATTGTCTCTGATAGAGATCCCCGATTCACTGG
GAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTGGACATTTCCACAGCGGATCATTCGCAGACCGATGGTCAAACGGAGTGTGTTAATAGC
GTCATTAATGAAATTTTGCGCAGTATTTGCGCTGATACGCCTAAGCGTTGGAGCTCCATGCTCCCTGTTGTTGAGTTTGCATTGAACAACGCTGTTCATG
CCTCTACAGGCTATACTCCGTTCTACGTAAACGGTCTCACCGCCCAACGCTACCACTGTGTGGTTCAGGGATTGGTGGGGGAGAGGTT