Description :
From Genome Similarity Track
Location :
Scaffold_129:12069- 14270
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_129-fgenesh-gene-0.4Prolyl endopeptidase

Sequence
2201 bases(100 bases per row)
TCACGGCGTGAAGGGCGTGCCCAGGTTCCACGCAATGAACGCGTACACTTCGGCGCTCTCTTCGATGGCCTTGGCCGTGGGCTTGCCGGCACCGTGGCCC
GACTTGGTATCAATACGAATGACCAATGGATTGGTCTGCTGCGGCGAGTCGCCGAGCTTATGCTGCAGTTCCGCAATGAGCTTGAACGAGTGGAGTGGCA
CAACGCGGTCGTCGTGGTCTCCGGTCGTGAGCAACACGGCCGGAAAGCCCCCGTTTTGAAGGTTCTTGATCTTGTCACTGTCCTTCGCCGGCACGTTGTG
GATCGGTGAGTACTTGAGCAGGTACGCAAAGTCCTCAGCGACGTCCGGGTCACCGTAGTCCGTGCGCCACGCGTGGCCGATCGTAAACTTGTGGAAACGC
AGCATGTCCATGACACCGACTGCACCGACCGCAACACGGAAAAGATCAGGACGCTGGTTGGCGCACGCTGCGACAAGCAGCCCACCGTTCGAGCCACCGT
GAATCGCAATCTTGGACGAGTTCGTGTAGCCTTCCTTAATCAGGTACTCGGCCGCGTACTGGAAGTCATCGAAGACGTTCTGCTTCTTGAAGAGCATACC
GTCCTGGTGCCACTGCTCGCCGTACTCGCCGCCACCACGCAAGTTGGGCAGCGCCAAAAGTCCACCATAGTTCTGCACGAACACAAGCCGTGCGACGCTA
AACGACGGCGTGAGCGAGATGTTGAAGCCACCGTATCCGTAGAGGTACGTCGGCAGTTGGCCGTTCAATGGTGCGGCCTTGGACTTGACAAGAAACATGG
GGATCTTGGTGCCGTCCTTGGACGGGTAAAAGACCTGCTTGGCCTCGTACAGGCTCGCATCAAAGCCCTTGACCTTGGTCTCGCGGAAGAGCTGCGGCGT
CGTGTTGCCATCGGCCAAATCGACTCGGAAGATCGAGCCCGGGTAGAGAAACGAAATGAAGTGGTAAAAGAATTCGGACTCAGTGCGCTTGCTCGCGATG
CCCACGGTGCCGATCGTGGGCAATGCAATCTCGTACTGAAAGACGCCATCCAAGTTGTACACGTGGAGCACGTGGCACACGTCCTTGAGCAGCTTGACGA
CCACCAGATCGCCCTTGACCGGGTACACACCTTCCAACACGATCGCATCTTTTTGCTCGGGGATCACTTCTTCCCACACCGGCGGCCACACGCCGCTCGC
GAGGTTCGCGCGCACAAAGCGTTCGCGCGGCGCGTCCAAGTTGGTCGAAAAGTAAAACACATCGTCCTTGTTGAGGATGTAGTTGTAGGCCGCGTCCATA
TTGTCGACGAGCTTCTTGGTCGTCACATAGTCCGATGACGGCGACGCCAGGAAGTCACCAAACGTTTCGAGGTCCGCAAGGTGGATCATGTTGGCGTTCT
TGCAGCCGTCGTTGAGGTAAATGATGAGCGTCTTGCCATCGTCCGAGACCTCCGAGGTCAGCGAGTACGTCGCGTTCTGCGGGTACGCGTACACGAGCTT
GTCCTGCGCCTGCGGCGTGTTGATCGCATGGTACCAGATCTGGTGGTTCAGATTGGCGTCCGTCTCGGTGCCGCGCTTGCTGTTTTCGGCATCGTCATCG
CCGGTTGCGAGCTGCTCCGGCGGCGGGTACCGCGAGTAAAAGAAGCCCTTATCGTCGTGGGTCCACGCGATGTTGCTAAACTTGACCCACTCAACGGTAT
CCTCGAGCACCTTGTTGTCGTCGTGGACCGCGAGCACCTTGATGGTCTGCCAGTCCGACCCGCCACGCGCAATGCCATGAGCAAAGAAGAGCTTGCCGTC
GTCCTGCTTGGCTTTTGAGAACGCCGTCGCGCCAAGCGCAGCAGTGCCGTCCGACGACAGCGTGTTCGGGTCGAGCAGCACACGCGGCTCACTCGTGAGC
GAGTCTTGGATGTAGAGCACGCTCTGGTTCTGGAGCCCATTGTTCTTGGCAAACACGTACTTGCCGGCGTGCTTGACCGGGCACGAGTACTTTTCATAGT
TGAAGAGGTCCGTGATGCGGTTCTTGGTCTCCTCGACAAACGGCACGTTCTTGAACACCTCCTGCGTCGTCTTGTTCTGCGCTTCGACAAACGCCTTGGT
CTCCTCGCTGTCGGGGTCCTCGAGCCAGCGGTACGGGTCGGCGACGGACGTGCCGTGGAGCTCTTCAGCGAAGTCCGTGCGGCGCACGGGCGGGTACGCG
A