Description :
From Genome Similarity Track
Location :
Scaffold_16:1206705- 1209539
Transcript NameFunction/comments
Phyin_T30-4PITG_08837Interferon-induced GTP-binding protein Mx
Phyin_T30-4PITG_08838Putative uncharacterized protein

Sequence
2834 bases(100 bases per row)
ACCAACTCACGACGAGATGCCCCACCCAACTCATTCTGACCCGCGCCGACACTTTCCGTGGCACCGTCAGACTCGTCCGTTATCAATCGGGTAGTGAGAA
CGGCGAAGGCGAAGAGAAACAAGACCTTAACCGACTAAAAGACGTCCCCGACTCTATCACGAAACTCACGCAGAAACTCGTCGATGAAGGCCAGTACATC
AGCGACGACCAGATCGTGATCGAGATGTGTGGCCCTGAGCTGCCCAACCTCACACTCACCGACCTACCGGGTCTAGTGCGCACGGTGGGTGACCATGAAG
ACCAGAGTCTCATTCCGAGAGTTCGGCAGATGGTTGACCGATACATGAAACAGGAGCAAACTGTGATCATCGCCGTGGTGCCAGCCAATGTGGATATGCA
CAACACGGAGATCCTACAAGCAGCTCAGGAAGCTGATCCGAATGGCACACGCACGATTGCAGTAGTGACGAAGGTGGACTTGGTGGATGCTGGTGCCGAG
TTGGCAGTGCACGAATTGTTGCTGAACAAGAAGAAGAAAATGCGTCTGGGATACCACGCCGTCAAGTGCCGTAACCAACGTGAACTAGCCAAGGGAACGA
GTATCGAGAAAGGATTGGCGAACGAGATGGCATTCTTTCGTCAGCACGAGTACTGGAGTCGTTTACCTACTCATCTGTGGGGCGTTCAGAGACTGACAGA
GCGCTTGGTTTCGATCTTGGAAGATAATATTCGACGTTCATTGCCAAAGGTGATTGATGAGATCAGCGCGCGCATGAGCGAAACCCAGAAGCAGTTGCTG
AAATTGGGCACGACATTGAAGTCGCCCGGTGCTCAGCGTCAGCAGTTTGGCAAGTGGGTCAACCAGTATCTACGTCTGATGGAAGCTGCCATGACGGGGC
AGTATGAACTCTTGTCACCTAATGGAGCCACCTCAATGCCAGAAGCGCGGCTGAGAGCTGTGCTGCGACGGAAAGACCGCACCTTTCGGGAGGAAATCGA
AGCTTCGAAGACAAGCGACGTGCTCGAATTTAACGGGTCGTGGTCGCCGAAGAAGGTGGCAGATAAAGGCAAAAGAGCTCAAAAGGATGTGGCTGTAGGA
GACACGATCACCGTACTTGGACATCAAGAATCGACGAGGTGGACGGTGACGCAGACCCGAGGGACTGATGTTTTATGTGAAGAGTTGCCGCACGAATGGC
TGGGTGCTACACGCTGGAAATTTGCGTCTGGGGTTATGGCGGCTAATGGCCTGAAGCAGTTTATTCAAGCGAATCGAGGCGACGAGCTTGCCATTTTCCC
GTCCTACCGCGTGTTTTGCAGCTGCGTCCAGCGAAGTTTGAGAAAGTGGGAGCGCCCAGCACTTGAACTACTCGAACGCTACTACTCGCATACGAAATCC
ACGTCTCACCATCTCATCTCGACGGTTTTAGCTGGTAGCGAAAGCACACGAGTCGAGAGGTTCTTCAAGAGAACAACTGACCGAGTGCTTGGTAGCTTGA
AGGAAGTTGCCGCTCGAGAGCTGCAGTTGTTGCTGCAGCACGAAGCTCGACCGTACACCCAAGACCAGCGTCTGTACGAGGAGCTGGACAGCCTTCGTCA
ACGAGCTTTACACGCCCGACTGGAAGCTGCGCTTCCACGCGGAGACAAGTACGGGATGGTATCTCTAGCCAATGTCACGGAAGCGCTTGGAGGGATCTCC
ATGGCTTCCGATGATCGTGAAGCTTTGGAGATGGGAGTTGCGCTACGTGCCTATCTGGAGGTGGCTTCACATCGGTTTATCGACGTGGTGCCTATGAAGT
TGAATGGGTTATTACTGGATTCGTTCGTGCGTGAAATGGAGAGCGAGTTGCTGGGTGCTGCCACCGATGAGAAAGTGGCTGAGCTGCTAAGAGAGAACTC
GGACAAGGCAGCTCGTCGTCAGCAACTCGTCAATGAGCTTTGTACTCTTGAGAAAGGTAAAATGATACTCGAGATGAGCGAATTCTAGTCATGCGGAAAC
AAGATAACAATGTTTTTGGATAGTTTTTTTTTCACCCTGGGTGATCGCTTCCATGAGTATTTTTTTCGCTCTTGGAATAGCACAAATAAATCAGCAAACT
TGCTCAATCTCGTTCTTCGCGCTTGCAAGACATGCAAGCTCTTCCTTAAGCTGCTGGCGTTCGTCCCTTTTTCGCTCCGAATCTTGCACTAAGCGAGTGA
GTTTGTCATCAGTGAGGCCATTAAGTGCGTTCGTCATTTCCGTGACAAACTTGCACAGAACCAGGTCGTTCAGTCGCATCGGAATTGCGTCTACAAATCG
TGGCACTGGCAACATCCAAGTACGTCTGCAATGCAACTTGCACCCGATTTTCCGTCGAAAGCAAACCTGACGCTACAGCATTAAGCACATCTCCAAGTGC
GACCTGACCGTTAGAGTCGGTGTGAATCGCAGCTTTGATCTGCTTCTGAACATCTCGCATGCGCCGTTGATCCAACTCGACAAACAAGCGCTCGTCTTGT
GTGTATGACCGGCTTTCGGCACGCAGAAGCGTCTTCATTTCCTCCTCAGCAGATTCAATAGAGGTATCAAGCGCTTTTGTAGCGGTATCGTTGACGAATC
GAACCACTCTCGCGTTCGCGTTAATCGTACCAGCCACGAAGTCAGAAACCGACTTGGTGCGGTCGTGATAAGTGCGTACGAGCTGTTTTGTTGGCGACTC
CCACTTGTCCACGCACTGACGAAACAGGTTACAAAACACTTGATACGAAGGGAAAATAGCGAGCTCATCGCCGCGGTTCGCTTGAATGAACCTCCTTAAC
ATCGCTCGCTCATCAAAACGCCACAGCTCCTTCG