Description :
From Genome Similarity Track
Location :
scaffold_45:120668- 122943
Transcript NameFunction/comments
Plaha_PHALS_10577Basic-leucine zipper domain
Plaha_PHALS_10578Protein of unknown function DUF3661%2C vaculolar transmembrane

Sequence
2275 bases(100 bases per row)
AGCCAAGTTCGGCTTCCATTTCTGCGATCGCTGCTTCATCACTTATAGTTAATTCAGATGCCGAATCAATGGAAGCATCTTGTTCTTTAAAGAGAGAAAA
GGAGAAAAACCGGCGAAGAAAGCGCGAGCCTATTATGCTTCCACCTGCGGTTGAGGGTGCAAAGCTGAGCTTTAAGGAATTGAGGCGATTGAAAAACCGT
GTTTCAGCTACACGCTTACGTCAGCGCTCTCAGCAGCTGCTTCAGTCAATGCAAGACCAAATTGAGTACTACCGAGCTCGCTGTGAGTTTTTGGAGATGA
CAGTGACAGGATGCGCTACTTGTGCAAACCTCAACACAGTGCAAATTGATGATATTGAGCTGTTGCCTGCGTCTAAAAAAGCGAGAATAGAGACTGTGTC
AGACTCGACAGGTTATATTAACGACGATGAAGGAATATTGCTCACGGATACCGAGTGTGTCGTGCTTCACAATGTACTGCACAATTGACTTATCGATGCT
GTGTAGTCTGAGGCAATCCATAACCAGAACGACGAGTAGTAAGGACATCGTAGTAAATTAATACATGATTGATTTGAAACATAATTTCGTCGCTTAGTGC
ATATACCACTACGGTAGGATTATGTGTTCCCAAAATGGGTATTTGATACGGCGCAAACTTGCTGCTGTGTAAGGTACAAGTACACACATCCTTCAGCTGC
ATATTGCGCTCAATCAAGCCGCACAAAAACATCCCCAGGATGCGTCCGCCTGCACAAGTCGCACAACAACAGAAAACATGTTAGATCTTGCTGACGTCAG
GCGAATACTTGCACGTCAACGCACAACGCAACTACAAAATCTCGTACATATCAGCAGCATTGGCGACATTTGATAGTCCACGTGACTTTTGTACTGCAAA
AGCGTCTCCCATCTGGTTCAAAAGTGGTATTTCCTCGTCACACTGAATTTTATCATTCTTTAAGAAGCTATCTTGGATCCAAAATTGCACCATATTCATA
AATAATGGACAACCAATCATCACAATGAGTAGCTCAATTTTCGGATGGTGATGTACAGGATAGAAAAGCAAATATCCCATCCATCCCAATGGCGTTGAGA
AGATAAAGAGCACGAGACCCACAATAACTTTCATGATTGTTAAAATAAAACACCATTGCAATAATTGAATCCACCAAATTCGCCACGATGGTGGAGATCC
ATAATACCCGTGACACCGCACATTTGTCCATTGCTGCCGCATTGCAATAATTGTAAAAAGCTGCAACAACAAGTATGCAATGTATACACCAAGTGTTGTA
TCGATCACAACATTCATGAAATAAAAGGCACACTACAATTAAACATCAAGGTTATCATGTTTATTATCGCTCTTCAAATGTAACAGGTTAAACTTACTTG
ATCTTGATCATTAGGCTCATCGGAAAAGTTGACAAGTccgatggcaaagaaaaTATTTATGAAGTGAATCATagcagctgatgtccctTGCTTCATGGCA
TCCATAAACCAAACCTTGACAGGCCTCCGTGGTTGTTCAAAATGCCATTTTGCATATAGAGATGACAACGCAATGAAGCCAAGAAGCATTTGCACGGCGT
CGTctgtgcgatccgctaaaagTGTGCATCTAGAGCTCATTCGTACTGTGAAGTTAATTTGTAACTGAAGTCACTGCTTAATACGTTAGATCTCTTTTAC
TTGAAATTCTATTGGTGGAAAAATAGAAATAGCTATCATGTCTCTGGATCTCCGTACATTTATGCTATCAGAGCTTTTTACTTGGTTTTTCGAATTATTT
CGTTCCGTTGACACTTTAAGACCTCCATTGCATCATTTCTGCAATTGTTATGACGCTGCAGATTTATGTTTGCTAATGACAAAAGATCTTTTGTTACGCA
TGGCAAAATTTCGATTAGGAAAATTAAACTTATTAATGAAAGGTAAAATATTGTTTAAAATGGGGTGTTGGCTGCATTTACGAAGTGTTTTATGATTTCT
CGCAGTGCTTGAATCACATGCACTTCGCTCTATTTCGACTTTCACCATAACGCCGTACAGCTGCAACCATTTCACGCTTTCGGGAGGCGCTTCGTTCTTA
TAAACAAAATTCGACTGGATAATCCTCATTGCATTTGTTTCGTAACATAacaaaaatatcaaattgTCGGTAAAGTTGTCTAATATTATGCTATCTCAAT
TTCAATGTGATTTTTCATTGTCAAATAGTACAATGTAAGCTCTTTAATATGTCAACCCACATAATAACTTTTAGC