Description :
From Genome Similarity Track
Location :
Scaffold_15:120664- 122400
Sequence
1736 bases(100 bases per row)
CGGCAAGTCGTCAGTGATATTGTAGTTTGCAGCAATTATAGATCCTTCTAAAGGAGCTATCGATCATCAGTGATCAAATTCGCTCAACCGAATCCTGGAT
TGCAAAGATGTCAGCTGTCAATCTCAGCACTTCAACGTTCCATAGGGCACTAGGCTGAACCAAAGGAGGTAGGGATGAGATCGTGCTTGCGTGAGGAACA
CACGTTTCCATTCAGTCAATTAAATGGTAAATTCTGTCTCATGAAGCAGGACGTGGGCCAGTGTAGTATAGTTCGAATATAAGTACTTTGCATAGACACG
TTGCAATATGAGCAATTATAGCCACACGCATCAGCTCATCTTGATGTCTCCTCCACAAAGTGCAGACTAATATTCGATTACTCATATTACACAACAGAAA
ACAAAATGGTGTGAGATAAAGAATAGTGTCCACAAGCAAAGTGTCACGAAGGCGACAGCTTAGGCTCCGATCGCCCATTCACGCTGGAAAGCACTCCACC
GATAAGGATTAAGTGAAGGCGTGGAATACGTGCGTATTCTTTCGCAAAACACTGTCGAACATACGAACGTGCGCTGTGAAAGGTGAAGTCGCGTTATCGT
GGGGATAAATTTGGATGCCGCAGCGGATCAGAACTATACTACACTGGCCCACGTCCTGCTTCAGGAGACAGAATTTACCATTTAATTGACTGAATGGAAA
CGTGTGTTCGGCAATTTTCTATCAGATGCACGCCCAGCAATTTCTACGACCCTAACATCGCAGTCCAGTGCTACGTACCAGCAGATCTTCACAATTAGTA
GCCACGAAATCTTGGCGATTACAACGAAAGGAGGCAATATAGGAAGCAGTAGAAGTTGCATAGGACACAGATACGACACAGTAAGAAGGAGCTTTAATGA
ACGAAATACAATCTCCCTTTTCTATAGATCACAGTGGATGTTTGTATCGTGTCCATCGCTTCCGAGTCAGTCGCAACTATCGCTAGTGTACTATTGGTGC
TATTGCACTGCGTTCTCGCATCAAAGCTAACCCACCACAAACACTTACCGTACCTTGATCTTTCGTGTCGACCGTGGTAAAGGGAGCCAAGGCAGCAGCT
TCTAGTTTGTATTCTTCTGCTTTCTCTTGCTAATAGAGAAAGCAAATGAAGCTTCTCCACGATCGCACTCATAATAGGTTCTTTATTTCTCTATCTGTTG
CTTAAAATGACTCTTTGTGACAGTCTGAATCCTTTTTTTAAACCAAACATTATTAACACACACACAGATAAGTACGATTTAAAAAGTTCGGGATTCATCT
TACGCACAGTCACTACTATTAGTGACTGCGCAACCATAAATTCTTTTTGACAAGACGATAGACAACCTTTATGTGCTCTGACAAACCCAACATTTGGAAT
CGAAGAATGTGACGTCATATGAACGCAGAAATTACATGGCATTAGCGCTAGAGAAGCCTTTCCGTCATGCACTCCAAAGGCTCAGCGCAATAGCTAGGAA
GAAGCATACAATGATTACAAAGAGTTAGTATGATGCTTTCTCGTTCGACTTTAGACGATGATGCAGATAGGAAGAAGTTATGTTGCCAGGAAAAAAAGAT
TTGATTCGCCGAGAACTTGTCTCGAGGAGATCATGATTGTTTCTGATGCTACACGGCTGAGAGTCTTGCAAAAATGTAAATCGTAAAATTCGAAATGAGT
GATGCCATTCCGTCGTTCCCCCATGACGAAATGGCA