Description :
From Genome Similarity Track
Location :
Scaffold_862:12066- 13975
Transcript NameFunction/comments
Phypl_g11336synaptobrevin-like protein
Phypl_g11337conserved hypothetical protein

Sequence
1909 bases(100 bases per row)
cGCGCTCGAGCACGTTGTCGATGGTCTTGGACAACACGGCGGTGGTCTCGTCTAGCTCCTTCTGGATGGCCGAGATCTTGTCGGCCTTGGACGGGTCCTG
GTACTCAGCCAGAGCCGTTGAGAGGGGCGCGAACTCCTGTGGGGAGCCCGACTGGGTCTTCCAGCTGCCACTGCAAGTAACAGCAAAGCGACAACAAATC
GATTAATATCCTCGAGTGACGTGGCACAAGACGGAACAacaatgtagccatgtccCTTACCCCGTGGACTTGTCGAACTCATCCATGAGcttgttgagca
gcgcgaaggccACGCGCGGCGGGTACTCCTGGTCGCACACCACGATGCCCGACAAGCCATCACGACGCACGTACACGTGGCAGTTGTACTCCTCGTGCTG
GATGGATTGCCGCTGCCCAGGCTCCGTGCGCTTGATGAACGTGCGACTGAAGAAGTTGATCATCTCTCGGACGCTGCGGCCAGGTGGACGAACATTGCAT
CGTAACAAACAGCACATGTCGTCACGGTCAGAGAGAGAGTTCGCCATCCTCTACCGTCCAGCATAGCACTGCACTGCACGGCGCAGCGTACCCTGAGCGC
TGGAAGTAGCCGAAGGACGACACTTCGAAGGCCGCCGAGAGGATGATCGGGTCCTGGCCCTGGGCATCTTGACGCAGCAACTCTGTTGACACGTCGGCAA
AACCGTAAAATAATGTCAGATATTGTGAAAGAATCTTGCATTTGCATTGCATGTGAAAGGGGGGGAGGGGCACGCACCGATAGCGACGATCTTCATGGTG
GTGCGATGCGGGCGAGGGACGCTGGCGAGGGAGGGAGCGCTAGACTGTGCAGTGCAGTGGCTGACTTCTTGGTGGGCTATTCGCGGGAGCCGGCGGTTTC
GACTGTGTGTGCGTTTGTTTTTCTCTCTCTATTTATTACTCAAGCGAGATCACAGCTGTGATTTGGCGTGTTGTGATTGGCCTGTGGGAGTTACTTGAAA
AATTGCCACACATTTCCTTATTCGTCGACGTGCGAGATGAGCGGCCGACCGTATGCGCGCAACCCGAGCGCGCCGTTCGCGGGGCCGAGAGACCTGGAGG
CGGTCCTTCCGCACGCGTTCCGCCTTGAAGCGCCTGTTCGTCTGCGCGACGCGAAGCATGAAGCCATCCGCAGGTACATTCCGCCCAGAagcgatggaga
acgtgCGGTGGGGAACGTGGCACTGATGTTTTATTATTTATTAGTGCCattcgccgccgctgcatGCAGAAAAACTGGCGCAAGATGATCAGCATCCGAC
ACCGGAGACTCGCGGAcgaagcggcggcggagagcgAGGCAGAGGAGAAGACAcacgaggagaagacgcgGGAGGAGTCCAAAGCTGCAGAAGTGAAGGA
AGACGCCGCGGCTGCCGCCAAGAAAAcgttgcaggagctggagcagaagctgcgggCACTCACAGACCAGAAGCACGCGAAGTTTcagctgctgaaggac
aTTTTAGTGGAAGAGGCCAGGTCCAAGGTGACGGTGGGGGGAAATGCTGCCCCTTCGACTGTCGtcgcgaagaagcggcgcgTGGAGTTTAAGGACCCCA
GCTTGACGCCCAGTCCAGCCAAGATGCAgtcgccagctccgtcgacCGAGACGGCGAACGCTGCCAGTCCATCTGCTGTGGGTGGATCAATCCCTCCTGG
CAGCGCGGAGAAGGCTTGAAGGCTGGGTGCTACGTGTTGGTGCGTCGTAGATGCTAGAAGACTGAGCTGCCGTGTGCGTATATATTTCCTCTTCTTTCTT
GGTGTTGTATTTATTGTTTTAGTTTGGCGAGTCGTTGGAGACTGTTCATGAAGACGTGTTCGCGTGTCCTTTCGTGGAGTTAGTTAGTCGGAGAGTCGGG
CTTTCAACT