Description :
From Genome Similarity Track
Location :
Scaffold_256:12064- 14355
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_256-snap-gene-0.8Lectin
Pytve_DAOMBR484snap-pve_contig_256-abinit-gene-0.47Protein kinase

Sequence
2291 bases(100 bases per row)
AACTGGCGCCGCGTGCCCGGCTCGCTCAAGCACGTGGTCGTGTGGGGCGACAGCCTCTTCGGCGTCAACAGCGCCGACCAGATCTTCATCGGACGCACCG
AGGGGGACCCGCAGTGGCGCAAGCTCGACGGACTGCTCAAGCAGATCTCGACCGACGGCAAGCAGATCTGCGGCGCCAACGCGCAGGACATGATTTGGTG
CGCCGACATCCCGACGGACTCGAACCCCAAGTGGCGCCTGATCCCCGGCTCGCTCAAGCACGTGGTGGTGCAGGATGGCGTGCTCATGGGGATCAACAGC
GCGCTCGAGATCTTCGTCGGCCGCGCCAAGGGAGACCCGAAGTGGATCAAGACCAACGGCTGGCTGCAGAACCTCGAGTACGACGGCGAGACCATGTGCG
GCACCAACGACGGCCAGATCTGGTGCGCTGACGACGGGTTCACGGCCGGCACGCTCAACTGGCGCCGACTGGACGGCAGTCTCAACTACGCGTCCATCAA
CGCCGGTATGATGCTCGGCGTCAACTCGAACTCCGAGATCTGGAGCCGCATGGACCTGTGAGCAAGCCGGCTCACAAGGAGGAGAAGGAGCAGAAGACTC
GCAGCTCTGGATGTAGCCTACGCGTTGAGAGTACGCAAGTTGTCGCCATCTCCACTCAGTAAACAATGAATTCTCTAGTGTCTGTTTCCCGGACTGACAG
CTCTACCCGAATCGGATGACCCCCGAGATGTTGCGCAGCGTGAACACGATCTGAAGCGCCGACGGGCGATCGCTAGCATCCGGTGCAGCACACGAGAGAG
CGAGCTTCGTTATCGCCGATGGACAGTCGCTGCGGAACTCTGGCGCGAGCTTCGAGCACGTGACGAGGTGGATGAGCTGCATCGTCGTCAACCGCTGGCG
GCTCACTTCGTCATTGAGCGAGAACGGCGGCAGACACGTGTCCAGCTCCGAGAGCACGATCCCGTACGAGTACACGTCGGCCTTCTCCGAGTACGGCTCG
CCTCGAAGAATCTCCGGCGCTGTCCACAGCAGCGTGCCCACGCCGCTCGTCATGGTCTCCTCCATCGAGCGCTCGCGGCTCAGTCCAAAGTCGCTCAGCT
TGGCGCGTAACCTCGCGTTGAGCAGCACGTTGAGCGACTTGAGGTCTCGGTGGATGATCACGGGCGATCGCGAGTGCAGGTACGCGAGCGCCTCGGCGAT
GTCGGTGGCGATCGACAGCTTGTCGCTGCTCCAGCTCAGCTGCTTACTCCGCTCGGAGCTCAGCAGCTCCGAGAGATCGCCGCCGTCCATGAACTCGGAC
ACGACGCAGAGCTCCGAGAGCTGTCGCCACGAGAGACCGAGGAAGCGCACGATATTGGGATGCACGAGCGCCGACGCGATCCGAATCTCGTGCGCGAAGG
TTTGCACGGCCGTTTTGTCGTGGCGCTTCTCGGGCAACAGACTCTTGATCGCCACGACGCGGCCACGGAACTCGCCCTGCCACACCTCGCCGTTGGCGCC
GCGAGCGATCAGTCTGCTGAACCTGAGGCTGTCGAACGGCACGCGTCTCGCCATGATCTGAGCGTCCGTGCAGATGGGCTGGAGCTCGACCGAATGCCTC
AGCACCGCCTCGCTCACGTGATCAGTGTCGCTGAGTCGGACGGCGCCAGCAGGAGTAGCAGCGTCACCTAGGAGAGCCACGCGACTCGTGATCGATTTGG
ACGGCGCCTTGAACTCTTGTTCCAATGCCGACAGCGAGTCGCGGGACTCGACGCCGCGCGACGCTGTCGGGGTGTCGGCAGAGTTGTACAGCGTGCGACG
CGTCCAACGCTTGCGTCGGCACTGAGAGAGATACGTGTACGCTCCGAGCATGGAGCAAAAGAACACTGTGAGCACTGCGGCGATGGTGATCAACGCGATT
GTACCGGTTGAGAGACCGGTGGACTGCTCTGTCACCGGCATCTCCTTCTCGATCCAGAGGTCGATGAAGGAGTTGCCGAGGGGTTGGCACCAGTCGCCGG
TGTCGGAGGTCAGCTCGATGCAGGGCATGACGAACAATGGGGTCGTTGGACAGTCGTTCGCTGACAGAAGATCCATCGGGGCTTGGCTGATGATGATGAG
CGGAGAGCTGGAGGTCACCGAGCTGTTGGAGGAGCTGGTGGATGCGTTGACCTGTGACTTGTACACTCGGATGTCGGGTACCGACGCGAGAGCGCCGTCC
TCGGACCAAATGATTGCAGCTGATGCTGGCTCGATCGCACGGATGCCATTTCGGACGGCGCACTGTGCGATCGAGCCGAGTCCGCTGAACG