Description :
From Genome Similarity Track
Location :
Scaffold_135:120635- 125558
Transcript NameFunction/comments
Hyaar_Emoy2810728transmembrane protein, putative
Hyaar_Emoy2810729hypothetical protein

Sequence
4923 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTCTGTACTGAGTATGTTGGCCCCTGATCTCTCTGGTCGCGTGGTATGC
TAATTGTGTTTGTGTGCGATAGTGTTTCTGTATGTGTGTCCAGAGGACTCACCAGTGCGTTTGAAAATGGTCTACTCGACGTGCAAAGTTACAGTGCTTT
CCGTTGCTAGGGACGAGCTACACATCACATTCGAGCACACTGTAAGCAGCTGGTCTTTTGGAGCTAAACTCGACGGAAGCTGATGATGGTTTCTTGCTTT
TTTAGATCGAGATCAATACTCCTTGCAGTGCAGTCGACGAGATCCGGTCTGTGATCGCGCCGTCCACAGCTGAGGAGCAGCTGAAGCCACGAGAGTTTGC
ACGTCCTGCTGCGCCTGGAGGTCGTGGTCGTGGACGTGGCAGAGGTAGGGGTAGATCGCACGGTCCTGCAGTCGCCCCCTAAGCATATCACGGCATTCCA
AGGGCCAAGTCCGTGTGTTAACAAAAAGTTCAAATCTGACAGCTAAACGGCGCCGTGTTGAATCTTATTGTACGAGCTTGTGGTCGAGCGTCTCGCACCT
GTGATTATTCCTACTCCTATCCCCATTTTTTTCCACAGACCTCCTACGCTGCAATCTATCTCCTGCCTTTCTTCTTCCCCTTCTTCTTTCCACCACTAGA
GGGCGTCGTGACTCCGCCAGCAGCTGCTGCTGCCTTGATCGTGGCCTCCTCAGCTTCCTTCTCTAACCGCACCTTGCGGGACTGCAGCTTTGGGATCAGG
TCGGCCATCTTCAGTATTAACGCCTTGCGGTTGGGAAGCTCAGGGTTCTCCAGTGAGCCATCCTCGCGCACAAGACGCACACGAATGCGACCAGCCACAA
GCCAGTCGCGTGGGTACTTCTTGGTCGGCTCCAGCACGTGTGGCAGCTTCAAGAACGTGCACACTTCCGACATTTCATCAGCAATTGGAGCCTCACAGGC
CATCGACTTGGGGATACGCCGTCCTTGCTGCACCGTTCGCTTGCTGTCCAAGTAGTTGGGATAAAACGTATAGAACATCGAGGTAGGACTACCCTCGGCC
AGTCCGTAAGCGTAAATAACCTTGGGACGCATAGCATCCATAGGTGGAACCATTCCACCCATACCAGGCATTCCACCCATTCCAGGCATTCCACCCATAC
CAGGCATTCCAACCATTCCATCCATTCCAGGCATTCCGCCCATTCCCTGCATCATTTCCATCATTTGGGACATATCCGGCATCCCGCTGCCACCGCCACC
GGACCCGCCAAACATCCCCATGAGGTCCCCCATGTTGCCCCCATTGGGTTGAGGCCTTGAGCGACTTGAGGGCGGCGGCTGGTTTAAAGATATGGCGTTT
GAGTCATAGCGCTCGCCCGCGACGTTGTCCTTGACGCGGCCCTTCCGCACCATTTCTTCGACACGTCGCTGGTGTGCTGTATAATCGGGATGGGAGCTCT
GGGTTTCGAAACAGTGACATGGCACGGTACGACAGGTCGATATCGCTGCGGCCGAAAGTAGTGTGGTACACAAAACCTGCGAACGGCGACTTGGGTTATT
TTGATCAAAAACGACTCGTGCTACAGACGATAAGCGAGAGACTGATAACGGAAAGTGAGATTTTGACCAATAAAAATTGCTCATGCGTTGGCTCCTTCTT
AGTTTTAGTATCGTTCGAATCGCACGATTTAAAGCCCGACTGTAATCAGGTGCGACACTTTGTCTTCCTGCGCTGTGAAGAAACACCATTTTGTCCCTGT
CTTGGGCTTCACGATGTCCACAGCTTTCCGTTTGATCCCAAGGTCCATGATTGAAGGCAGCTTGCCGCTCCTAATCGGTGATTTTATGCAATGTACAAGC
TGTGTGTAATCTGACACCCATCTTTAGGTACGTCCGCATCTTATCAAGCAATCACGATGACAGGCCTAGACTATCGTCTGCCCAAGAATTACGGATTCTC
GAATTAAATTTAAATGCGAAGCTTAACAAATAGAAGCCTTCGTAAGTGAAGCATACACCATTGAGTTGCCTTTCGGTCAATGACATCAGTTTATAGACAG
TAGAAGTGGTGGCATCAAAATCTGTAATCTACAGCTGTACTCACTCGCGCAGTGCTCTTGCAATCCATTTCTGCCATTAATTGGTAGCTCAGCCTGCTTT
CTTAATTTTGACGAGATGAGACTGTATACATCTTACTTAGGTAAACATCTTGCAATTTAATTGATACGATCGACATCACCAAAACTTGTTATTCACGATG
GCAGCTGCCAAAAATAGATCCACCAAAACATAACCCGTGCCAAACTCATATGACGACTGCACTCGCTACTAGCAACATTGTTCATACAGCTCCGTACCTA
CAGTTTATCCATCAGATGTGCGAGGTAATCGAATTTCTTGAATCAAAGCGGAAGGATGTGCAACCTTTTGCAATGTGCGCAGACGCCCCTAGGCGCTAAT
ATGACAACCTTGCGGAAATAGCCATAAATACACGTACCTGTTCTTCCTAATGTGACCCGTACTGGTGGCCAAAACATTCTCACGGATTTAGTACTGTTGT
TGTTGTCTGAAAAATCGGTATGGCTTTCCACGTTAACACTGCGGCTGATCTTATCGGCGGTTATACGATTGTGAAATGATGATTTATCGCGGACAGAACA
TCAGTGGTTGTTAGAGGCTGTATGCTTTGTACCTGGTCGCCAGTGCACAATGTATAAAAGCGTCTCCTGATTGATTGGAATCGTAACTCTACCCCCGATG
TTGCTCCGATCTGTCTTCAGTTGCACTTATCATTAGAGCGTCTTCAGCAGTGAGTATAACTTAACTTTTTGTGCGCCAATCAGAGACCAGTATAACTTCC
TCTCAAACTTATACGCAAAAAACTTCACAGCAGTCAGTATAACTATATAATATAAGCTTGCTCGTCGTCCGAGAGGTCGCGCACGTACTTGGCCGGGTTG
CCCGCCCAGAGTTGTCCCGCAGGAATACGACGTCCAGGCGGCACGACGCTGCCAGCTGCAAGGATCGTGTTGGACTCGACGAGGGCACCATCGAGAACGA
TCGTGCCCATGCCAATGAGCGCATTGTTCTCAATGGTGCACGAGTAGAGCGTGCAGCCATGGCCGACAGTGACGTCGTTGCCAATGTGTGCGCCTGGGGC
CAAGCCCGGACTCGTGGAGCTCGCTGTGTGGATGACTGTACGGTCCTGCACGTTCGTGCGGTTCCCAATACCCACTTNNNNNNNNNNGTACGCACAATGT
GCTCTCGAGTATACGCCTCAAGCTGGCTCTTACTCGTAATGATCTGCTGACGTCTAGAATAGGCACGTGTCAATCGAAGATCAAAAGAGGAACTGAACTT
TTATTTCTTAGTTTATCTGTAATAAACCTCATTCAATACCTAACACTAAGGTTAAACTAATTCGCATATTAATTTTCAGTCCATTAAAGATTAATGGATG
GTACATCAATCTGTCATCAATGGATGATTGAGATTATCAACCACATCAATTATCACAGATAAAACTTGGGATTGTATATCACATATACAAGGTATATCCC
TTTAGGACGATAACGGACGTGTGACCCCGTTACACCCTCCCCCACCAGACTGACGTTACCACTTAACGTCAATTGAATCATTACCTCATCGAGGCATTTG
GCGAAGAGTAACCTCACGGTTTGTTCAACGCGTCAGACATGGCAACACCAAACGAGTCTTCGGCCTTTTACAACCTCCTCGGTATTGAGGAGGAGGAACT
GGACTATGGCGGCGATGTCGAGTCCAAAGTCAGCACACTTGTGCGCGACGACATGTCGAGACAGGCAACTAATCCGTTCCCTGAATGTATGGCTGCGAAT
ACACGAACAGCGCTGCACACGACACCCGGTATGAGGTCGGCAATCATCACAAAACCACTCAACGAGGAGCAACAGCAGGTGCCCCAACAACAGGAGAGCA
CTCAGAGCAGATCTCAGATCATGTCGACACTCGAAAGTCATACTGACTATGTGTTTACACCTCTCAGTTTGGAGGACCGTCTCCGACAAACGACTGGTCA
GTCTTTGGCATCGTGGACCATTTGTCCGGCAGCCAATACACCTAAAGAGATTGAAACAGGCAGGGTATTGCGTGAGCAGCACCTGGAGCCGTATGTTATG
ACCTTAAGTCAATACAAGGTATGGATTTTAGACCAAGGTCATGGTGTACTGGTTTCACTGATTAAGGGTATCCCCGTACCCTAGACGTAGGGGAGCTGGC
TTCTGAAGAAGACAATGCGNNNNNNNNNNGATGACTTAATAGGGCCATCGGAAAAGACGCGCTCATGTCGCTGTAGAGCGATTGCAGATTATACTTGCAT
CGCACATCTCAGAAGAGATGTACGCCCTACCCCAGGGCGAAGAAAGGGAGTGCACCTCTCTTTGGATGCGTTGAGTCTTGTAAAAATAACGCGGACACGG
GTCTCCCACGTGAGGCTTGAAAATCCTGCTTCACGAGACAGATTGTACAGTCTGGCTTTTGCACCAGTTAAGGCTCGTTTCTCAAACCTATCACGAGCTG
TGCTAAGTTTCCGAAGCCAAGCT