Description :
From Genome Similarity Track
Location :
Scaffold_103:12063- 18953
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_103-snap-gene-0.29Inositol polyphosphate multikinase
Pytve_DAOMBR484maker-pve_contig_103-fgenesh-gene-0.3Dtdp-4-dehydrorhamnose dehydrogenase

Sequence
6890 bases(100 bases per row)
GGAAGCACTCGATGAGCGTCTGCAGGCCCGTGCACACGCCTTCGTCGCGACTCGGCGGGTCTGGGTGCGTCACGTGGGCGAAGTCGATGAGGCGGATGTC
GGGGGCAAACGCCTGCTGGAGGTCGCCCGGTGGAACACCGCGGTTCGGCTCGCCGCTGTACACGAACAGCAGCGAGCTGGCCACGAACTCGGCGTCTTGT
TGCGTGTCGAACCACGCGGCGAGCGCCTCGAGCCGTGCCAAGAACTGCGGAACATACATACACATGGTCAACCATCATGAGACTATCGATCTATGCTGTT
CATGCAGTCGCATGGCCACTGACCGCCTGGAGCAGGAAGCGCGTCTTGTCGCGGTCGTCCGCCGGGAAGAAGCGCGCGAAGGCCGGCGGCAGTTCGTCGA
TCGTCGCGGGTCGGCGGCCAAAGTGCTTGTCCAGCTCGACGTACGCCTGCGCGGCCGCGTCGAACGCCTTGATGCCCTGCAGGCGGAAGCCGGCGGCCTG
CTGCAGCGGGAACTTGGACTGCTCGTACGCCACCTTCTCGGGCGTCGCGTCCCGCTCAAACGACCGCGTGCCGACCTTGACGTCCATGATGCACGGCCAC
GCACGACCGAACGTCAGGTCCTCGAGCACGAGAAACTCTGCCAGGCATGGGGGCAATTAGGATATCTCGGTTCGATTGTACTAGCTTGAAGTGGGAAGTG
CTCCGTACTGTCGGAAGGAGCGCCGTCGTCCGATGGAGGCGCCTCCACGACACCAAAGTACCGCGGGACGAAAGGGATCAGCGATGTGAGAGCTGGAGGC
GCATCGGGGCCGAACACGCGCGTGTAGAACTCGTGCTCGCGCTCGCCGCGCCGGCCGCTCTGGAACGGCTTGAATACTTTGCCGTCGTGCGCCTTGAGCC
CTGTGGCGCCGCAACGGGCGTGAACAACACCGCGATCGATAGAGCATGCAATAGACAAGCGACGTGCCTGCCTTGGGGCCCGCGTGGCCGCCCACTTGGT
GCGCCATGTCGCCGAGCGCGGCGACCGCCGCAGCATCTAGAGGCTCCATGTTGACTTCCTCAGCGAAACTGCAATCTGAGAATGTCGCATTGATCTGATT
CTTGTACTTGCTGATTGTATCGATGAAGTTATGGCCTCAGATTTGAAAGTCAATCGGATCAGAGTTTGTGTATCATTATCAGATTCTGCATGTCGGAAGC
AATGCCGCGCCGCGTGCTCGTGCTCGGCGCTACGAGCTACGTGGCGCAGTTCGTGCTGCAGCGTCTGGTGCGCGACGAGGCGGTCATCGTCGCCTGCTCG
GTCCGCTCTGTGCCTGACCCGTTGCCCGCGGGGTTCGTGCTGGCAGGCGCTCGGAATGAAGGGGATCACTTGGCTGATGGCAGCGACGTCACAGTGTTCC
CCGGCGTGGATCTGGCCGAGGTGGCGTCACTGGAGGCGTGCATCTCTGCGTTTCGACCGGATCTTGTGATCAACTGTATCGGTGCGTATGGCGATCGTGG
TTGTGGTGTACAGCACTCGTGGGACGACGACCAATATGTGTGTCGTGCTACAATTACCAGCTCTGTCGTCACCCGCTGCTTGCGAGAAGAGCCCCACGCT
CGCGTCCACCATCAACGAGGTAAGATGGTTAACGGCATTCTTTTCCTGGTACTGTTGGATTCACGTTGCGTGTGGTGGTGGTGCAGCCCTATGTGTTTGT
CGATTTTCTCCGCCAGCTCCCGTGGCGCGTCCACCTACTGCACTTCTCCACGGTGAATGATCCTGCTGCCACTAGCCGCGATGTCGAGCATCATCACAAC
TAACATCTGACCGAACGTTGGTGGATAGGACTTTGTCTATCGTGGAGACCAAACGTCAGGCTCGGCGTATGTCGAAGAAGCGGCTGCCTTGGACGACGAC
GCACCGCGCTCAGTCTACGCGACGACCAAGCTGCGCTTCGACACGTACCTGCAGTCGCACCCGTTGCCCGGAGGATGCACGGTGCTTCGGATCGCCAACG
TCCTCGGCCCACGCGCGCCGGTATTCCGAGGCGCAGAGTCGCCAAAGTTCATGGAGTGGCTTCACCTCCAGCTCTTTGCGCCGAGCACTCAGGATCAGTC
GCCGGTGAAGCTGTGGAGCGACGAGTACCGCTCCTTCATCTACGTCGAAGATCTGGCGGCCATTGTGAACGCGCTGCAGGCAGATCTGCAGCTCGAGCCG
ATCACGCGCCTGATCAACGTTGGTAAGATGGTCAAGTCGTCATGATGTCGGGATGTCGCAATTTGGTGCTGATGTTTTCTTGTATCAGGTGGTCTTGAGG
CACTGACGCGTGTGGAGGTCGCGCAGCAGTACGTCGTTGCGTGCGCGGCTGAGAGAGAACGAGCAGGTGCAAGCCCCGCTACCTGCCGCGAAATCGAGCC
AACCGCCCGTGCACAGGTGAAGCTCGGTCACCATTCGCCTCTCGATGCTCGGCTCAACACGTCGCGGCTCGAGAAGCTGCTGCCTTCGGTGCATCGAACG
CCGACGGTATCGTTCCTCGAGACCATCGCGAGAGAGCTTCTCGTGGACGATTCTAAACCTGCTGAGCAGTCGTAGAAACGAAGAGGGTGATAGCGAGTCC
AGCAACATGAGTTCTTCATTCCAACTTATCGCAGCTAGACGCGATTCCTCAATTATCGAATCGAACGGAACTAATGGTCAAACGAAAGTAAATCAACAGC
AACTGGCGATGGTGAGCAAACGATCGAGTCCACCTTCAGAATGTCACACTATGTCCCGAAGGTCGCTGACGCTCGAAAAGTATGGTCGCCTGATCTGGAA
CGGTTTGCTCACTGAATCTCCATCACGTTCCCGATAGCCGCTTGAGCCTGCGCCAGCGCAAGCGCGACAGCCACGTTGTCGTCGACCTCCTCCTCCTCCT
TAACAAGAGCCTTCGCCGCCGCTGGCGAGCACAACTCGATGGCGCGGCAGGCCTCTCCAGGCGACTTGCCCGTCTGCAGCAGCGCGACCAGGTCGTCAAA
CTTGGACGAAAGCGCATCGCAGTGAGCGCTTGGCGGCAAAATCGTGCACATCGTCTGCAAAGTCGTTCGTGCCAGGCGAAGCTCCTTCTCGTTATTCCCG
GCGAGCTTGAGCAGCCCAGCGGTATACTCACAGAACAAGCAGCCGACTGAAAACGTCTTGTCCGAGTCGACAATGTCGTTCGAAGAGTCGCACGCGTCGA
TGCCAGCACAGATCGAATCGACTGTCTCGCCATTGATCAAGCCGGTCACAATCGCGTCCTTGTGGTTCAGCAAGAGCTGGCACTCGTCCGATTCTGGGAT
GAGGCGGCACACGGACTCAAGCTCGTCCTCAAACGTCGCCAAACGGTCCGGCTGGCTGACCATCGACGCCAGCAGGAGGGTGTTCTGCTTGCACGACGAG
CACTTGGAAGGAGCAGTGTCGGTGTCGACGAAGCGCAGCATGTCCCACACACCCAACGACGAACTCGAATCGGTTTCCGTGCAGTACTTCAAGTCCAGGC
AGACTTCGTGCGGCTGCTTCCCGGCTTCAAGCTCCTTGACAGCCTGATCGAAAATCTTCAGCTGTGGATGACACTACATTCGGTACAATAAAGACAAAGG
TGTTAGTGATGTCGGTTCATTACCCGCCAGAATAGCCATGGTACCCGTACCTTGTCGTCCGCAGGAAGCAATTCGCACACAATACCAGCCGCTTCACGAA
GCTGCTTGACTTGCTCGGCGTCTTGCGCAAGCGCATACTTCAGCACGGTCGCGAGACCAGTGCAATACGCGCATATCGAGCTGCCCTTGTTCTCAACGCT
GTCGACGATGGCTTGGCGTTTCTCTGCAATAACTGATGTAGCCTTGCAGTACTTGAGGTCGTGGCAAATGGTTTTCGCATCCTGTCCCTTCTTCAGCGCG
TCCACGACGGCGTCGAAGTCTCTCACGTATTCATGACACTGCCACGAACACCACACACAAGAGAGTCAGAATCAACAACTCACAAGACAGTTTGGCAATA
TCCATAATACCTTGTTGTCCGACGGAAGCATCCCACAGACCATGTCGGTGATCTGGCGGATTGTGTCCAACTCGCTCGGATTCTGCTTCAGCACAACCTC
AATCACCGTCGTCACTTGAGTGCAGAAAAAGCACGGGTCCACAGTCTCGACCATCGCGTCTTCGATAGCGAGAACAACGGACGGATCAAAGTCATCCGAC
ACGTCGCTCGGCTCTGGCAGTGCGAGAGGAACGGAAGGGAGATCAGCGGGACAATACTTCAGCGACATGCAGATAGCACGCGGGTGGGTGCCGTTCTTCA
GCGAGTCTAGCACAAAGTCCAGCTTGTCAACATACTGGTGGCAAACACTCTTTTCGCCGAGCAGAGCGCAGAAAGCGTCCGCCATCTGGCGCACCTGCCC
AGTCTTGTTGGCATCCTGCTCGAGCGCGACCTGAAGCAGTGCAGTAACGTAGTCGCACAGGAAACAGTTCACCCCGCTGTTGCTCGCTTCGAGGTTTCCA
GCTGTAGCGAGGGCAAGCACAGTGTCCTCGAACGGCTCGCTATCAACCAGCTCCTCCATCAAGGTCGACGATCTGTTGCACGCGCCGATGCTCTTGCAAA
TCTTGATCGGGCACGTCTTGTTCTGGGTCAACTCCACAATTTTGTCAAAGTTCTTGTCAACGAGATCGCAATTGCAGTCGGCGGGAGCCAACTTGCACAC
ATTGTCCAGAATGGTCTTGACAACCGGGAGCTTGTCTGGCGCCGTGGCGTTCACATGACGGACAAACAAGGCGACACGGACACAGAACTTGCATCCGTGG
CGGTGGTGACCGTCAACCGGCACAACACCCATTTCATCATCATCTTCATCCTCATTCATCGCGATGGCATTGCCATACGCCGCACAGTACTTCAGCTCAG
CGCAGATGGCGTGCGAGCTCTTGCCTTCCTTGATCAAGTCAAGCACCGTATCGAGCTGGCTCACGTACGCGTGGCACCCGCTGTCCGCGCCGAGCATATC
ACAAAGCATGTCGGCGTACGCACGGATCTGAGCGATCTCGTCGCCGTACTGCACGATCGCAACACGGATGATAGTAGTCGCAAAGGTGCAGTACGCGCAG
TTGGTCTCGTTTCCGAACTCAAGTCCCGATGAAACAACAAGGCCCTTCATCGCTTCCTCCGCAGTCAAATCTTCATCCTGCTGCACCGTGTCGGTCTTGT
TGCACACACCGACTGTCTTGCAGACCTCAAACGGACGCTTGCCTTCCTTCTCCAGGTCTACAATCTTGTCAAAGTTTTGGAGAACGACATCGCACTTGCA
GTCCGCAGGAACCAATTGGCACACGTTCGTCAGAATGTTCTTCACGATAGGAAGTTTATCCGGGGAAGTGTGGTTCACGTGGTGGATGATAGCAGCCGAG
CGGACACAGAACTTGCAAGCGTGGTTGCGGTGGTGGCCTTCCTCAGTAGCAACCACCAGCGCCTTCTCTTCCTGTGCGTGCGCGATGGCCGCCGTGCAAT
ACTTCAACGAATTGCAAATATCGCGCGGGTGCGTACCCTTCTTCAGCGCGTCAATAACCGAGTCGAGCTGCTTGACGTACGTGTGGCACTGGTTTTCTTC
ACCAAGCATGTCGCAGACCATGTCGGCGTACGTTCGAATCAAGTCAACCTGGTCGGGCTGCTCCTGAAGAAGAATCTCAAGCAACGTCGTCGCAACGTCG
CAGTAAAGGCAAGCGTTGTCGTGAAGTGGCACGAGCTGGTTCTCAACAAGCTCAGCAGACTCCGGCGATCCGATGGCAAGATGCGGATGTTTCTTGCAGA
ACCCCAGACCCTTGCAAGCCTTGTGCGGGTGGTTTCCCTGCTTGATCAGGTCAACCAACTTGTCAAAGTCCTTGTCAATGTCGTCGCACTTGCAGTCCGC
GGGAGTCAATTGGCACACATTGTCCAGAATGGTCTTGACGACGGGCAACTTGTCCGGCGACGTGTGGTTCACTCGGTCCACCACTTCGGCAACACGGGTA
CAGAAGAAGCAGGCATGATCCTTGTCATCGTCAAACACCTCCACGCTCGTGTCGAGCGACTGAGCCAACACCGGGGTTGGCGACGGAGACGGAGTGCACA
TCGACAGCCACGTGCACACCACGAGCGGGTCCGTTCCGTGCTTCAGCCAGTCGACCACTTCGTCGTAGTGCTTCAAGAAGACGTGGCACATCGAGTCCGC
CGACATGGCATCGCACAGGTCGCCGATGATCTGGCGCACCTGCTCAACCTGCTGCACTTGGTCCGCGAGCGCCTGGTCCACCATCTGCACAAAGCGCTGG
CACATGGTGCACGAAAGCTCACCGGCGACTTGACCCTCCCCGGAGCAGTCCTCCAATTCGTACACACCCTCATCCTCGACGATGGGGGCAACAGCCAGCA
GCTCACACACTTCTGCATCCGACTTTCCCTCGTAAAGGTACGCTCGAATTTGCTCTTCCATGTCCACGAACCGGTTGCACTAGCACACCCCAGTGATTCA
CGTCAGTACTGTATCCAATCCAAGCAAGCGAAGATGAAAGATTCACAGTACCTCATCGACGAGCGACGGCGTCTCGAGGTCGTCGCACGAGGTTTCGTCC
AAGTAATGCACCGACACGAGTTGGAACGCCGAGCGCAGCGACGCGTGCAGCTGCGACGCCAGCTCGTTCCCCGTTTCCTTGAGCTCGTCCTGCTCGTGGA
GTCGCGTGAGCGCCGTACGGCACGCCATGCGCTGTTCTTCCACCGTCAACCCGCTCGGAGTCTCGGCGTCGTCTTCCTCCGTCACAACGATCACGCGGAC
GCCCTCGTCCACAGGAACCCCCAAGCCCAAGAAGTGCTGCAGCACGTCGGCCGAGTGCTGGAACTGCTCGTTCAAGTAGTCGACCAGCCC