Description :
From Genome Similarity Track
Location :
contig_60:120604- 130565
Transcript NameFunction/comments
g9068.t1hypothetical protein PHYSODRAFT_343916
g9069.t1hypothetical protein PHYSODRAFT_476538
g9070.t1hypothetical protein PHYSODRAFT_284317
g9071.t1hypothetical protein PHYSODRAFT_322325

Sequence
9961 bases(100 bases per row)
GGAGGAATTCTTGCCTCGTTCTCGATTGCCCTGTGCGGCATGTTTGAGCGCCTCCCACCTGACGCAATCGCTGAACCGCAGCTTCGCGAGGTCTTGGATG
CAATTCTCGCTATCCTTGATCATCCATTCGCTCTTGGAGATTTGACCCGAGCGCGCAACGCTGTGGGTTTTGTGCTGCGCTATGGACTCAATGGGTGCCT
CACAGAGCGTCAGCAAGATGTGCTACTAGGTGCATATTTGCAGAAGCTGAAAGATGAGGCTCAGGCAGTTGAACCGAACCACCACAAGATATTGTCTACC
TTGGTGGAGCTGAGTCACATGTTCCATTCGATGGGCGAGGCTTGTGTTAGCCATGCACGCGACGCTAGTGATCTACTCCAAGGTCTTCTTAGTCACGAAA
AGCAAAGTGTTCGCTTCCAAGCTGCTGTTGCGCTGTCTTCGCTTGTCACGGCAATTCCGTATCGGCTAAAGACCGTATTGACAAGCTGTCTTCAGGGTCT
TCGGGATACTGCCGAGTATCTGATGCGTGGTGGCTCGGATTTGGAAGAAATGAGAAATTCAGAGGCTGACAAGACAGACGATGGTCAAGAAGAGGGCAAC
GATGTACAAAGCAAGACCCACTTGTATGCGATTCAAGGTAGATCCGCGGCAATCGCTCATATTCTTCGCGCCATCAAGCTTGATGCTAAGGGAGGGTTAT
CCCAAGCGGCTATGGACGATATCTACTCCATTTCTGAAGAGCTCGTCGAAAGCCAGTTCCTCAGCGAATGCGCTGATAGTATCTGGCTCACTTGCACTCG
TGCAGGTTGGACTTTGGTGGGAAGTCTTGTGGCTATGGACGATAAGCAGTGGATAAAGGCTAATCTGGAAAAGCTCCTGAATCTGTGGCTAAAATCCAGT
GTGATGCACAGTCGCGAATCATCCCTCGAGCTTCTGCGCATTGAAGCTGCTGTGATTGCTCTGAACAGCCTCCTATCCAATTCTCAGGGTATCGCAGTAG
ACCCTGACAACAATGTCTACCTTCTTGCAAGCCACGTGCTGCACGTATATTTGACGGCAACGCAGGACACCCTCAGCCACCCACTTAAACGGCGCGGCCA
AATCGCTCGGTATCGTCTGATGGGGTGGATCGTCAACTGCTTTTCAATGCTTCCACCGATATTCAGCGATTCGTACATCGTACTTTTGGATTTAATTGCT
GAGTTCACAACGGCCCAGGCGCTCACAAACCTCAGGCATTCATCGTTGGTCCCGGCGAAATCAACGTACTTGCTAAGTGTGCTTTCCCCGGAGGATAGCG
CACTCGACATGGTGACCCTCTCGAGGTTGGTGGCGGGGGATAATCCATCACCGCTGTACTCAAGAGAGCTCAATCACGCGCTAGGATTGCAACAACGGGA
AAACGCTTTGACGGATACTGAACTCGAAGTGCAATACCTTGACACGTTTTGGAGATCAATCAGCGAACGAGAAGTTGAGGATGGTGTACGCAGACGAGGA
GTTTGCAGCCCGTTCACGTACGTTCGACTCGTGGATGCAAGTGTGCTTTTGTTTGGTCGACTTTTCCACAGTATCCCAGAAGATCTGCAACTGCGGTGCT
TACAGCACTACGCAGGAGCCTTGACTGATGTCCGAGTTGAGTGTGAAGTCAATGTGTGCGCGTTGCTATTTGCTGTGATTGCTGAAGCGAGGCGTCTCGA
AAAATCTGGTACCGCACCAACTCCAACAGCATCGCTTTCTGCAACGTCGTGGCCTCTTCAAATGCAAACGATGTTGTGTGAAATGATTTCAAGTGAAAAT
GCAGAGGTTCGTCGTGGTGCAGGCGAGGCATTGGGGACGCTGGCACTGCTGCTTGGAGAAGATCATTGCAAGGCGCTCATTATCGAATTGGAGAAACGAT
TGGTGGTGGATAAACTTCCTCAAGGAGCTTCTAACGTCACATACGGCTCCAATGCTGATCTAGATGTTTCTGTTTTATCAGCCGGTGCAGCTTTTGCTCT
AGCATGTATTAAACGAGTGTGTGGTTCACGCATCTCAATCGACACAGGACTCATTTTCCGATTTGCAGGTGAGTGTTCGCAACCGCTGCGCACATGGATC
TTACATTCATGGAGCATTATTCTGGAATCCGTTAATTCAACGGGAGGGGACTACGAGCAGTTTGTGAGCTCGACATTTTCTCTCTTGGAAGCACATGTGC
TGGCAGGCTTTGTCTATTCCAAGGTGAACAAGCGTGGACTACGGTGGCAAATAAGCACAAAAGTAGCGTTGGGGCGGATTATTAACGAGGTGGTAGCGAC
GCTCGGTCCGGAGCTTGGTGGTTCTAGCGATCGTTTGAACGATTTCTACTCTTACTGGATGCTTCTTCGTCAGGATGGCGACGCTCGTGTTGAATTGGAG
TTCTTGAAGTTTCTGGAGCAAGTAGTCGTGTTTGCACCGTCTCGCTTTCAGTCTGCAGATTTAAATTATATTCTGCGTATCGTGTCTGATACCGCTTTAT
TGAGCTCGGCAACCCCAGCATCGCTGGCATCGCAACACTCAGGCTCTCCAATTTTGTCGCCGCCGTCTGGACCTGGACCCTCTTTGGCTACGTTGAGCGC
CTACGGAGATTCCTTCGAGCAGAATGGTCTCGTCAATGTGGGGGTCTTTACAAATGGGTGGAGCCGAAGTATCCTTCAGAATGTTGGTCTGTCTTGCATT
CGCACGCTGGTAGAAAGGGATCCGACATTGATTCGACGTCAAAATCTGTTTTGCCTCCTGTTTTCGGCACTTCACGTGGAGTACAACGAGTTGTTGTGGG
GTTATTTGCCTGGATTGCACGGCATGTGGGATGTGCTCTCTTTCTCTTTTGCTGATTCTACGACCATGCAACGGAATGGAATTGGCGCACTGCAGAGCAC
AGCCCTGGCACTACTTGACGTGGAAGGCAGAGATCACGAAGGTGCCGAACCATGTTTATGGGCTCTGCTGTGTCGTAGCATTGCCATTGGCGAATCCGCA
AGCACATTTGCGGGGGCTGGTGGAGGGGAGCTCATGATGAGCCCAAAGGGAATGAACTCTGGTATTCAGGCAGCTGGAAACTCCGAGGCTGCAGGAGACG
ATGATTTGTCGGAGTGGTCCCCAACGCCAAATCTTGATCTGCCCAAGACTGACGCAAGCTCACTTGCATCTGCTGCAGCTGCCGCCCAAGTGGATACGTG
GCGTGCTACAAAGGCAAGTGTGGGTGAACTCATTGCATTGATGCCCCCCTTTCTCGTCAAGTACGCCACTTTGCGGTGGAATGTGTATTACGCGTTTTTG
AGTTGATGGTGTCAATTCCACCATTGACGACTGGTGTGTATCAGACTAAGCAACTCCATTTTGATTTGGCTGCGGCTCGCCGGTATTTTTTTGAGGTGCT
CTCTGCTGGAGCTGCGTTGCCAGTGTCCACCATTGGAAATTTCTTGTGCATGTATTTGGACGAGTTTGTCACTCTCGCTTGCCACGTGACGACGACGTCA
GCCGAAGGAGACGAGCTTCTTATGTTCCAATGTGTTGGTGCTCGTTTGCTTAATGTGCTGGTCAAGAACTTTGCCTCTGCACGTGATCCAGAAGTTACCG
CTGGGGATGCTTATTTGTTAGACCCGTACCGCGCTCAGCTTTCGTCTGCTACCCGCCATGCTCTCAAACAAGTGCAAGTCGAATCTTCGTTATCGGCCTC
TGATAAAGAGAAGGATGAGGAACGATATTTCTACGCTCCGCTCCTTCTGGAGGCTCATGGTGTCGCTGGAGCCTGCGTCTCAGCTCATCTTATTCAAGAT
AAGGTGGGGTTGGGACGTATCCTGAGAGCAGTGGTGATGCCGGACTATGGCCACGCGCATTTCATTGGAGACGAACTCACGCGCATCTCCCTTTCGCTTG
CAAACCTGGCATCTGTGGGAGAATTGCTAACGTCAAGTATCACTGAGGCGATCGCTAATAAGGATGCGCGCGATGACGAACGCCGAGCTATCGCAACTTC
TCCACTAGTGAAAGCGATGACTAATGGCTTATCGGGGACCACCGAGTACTTGTTTAAGTGCTGGATGATACAACATTCGCGTACGGTGTCGTGATGCAAG
GTTGTCCACAGTGGGCGCAGTTGGGTGCAACTTCAAGCGTGTCGTTACTTTCTGACGAGGTGATGGTTATGCCAGCCTTACAAACCGCTACCGCCCGTGG
GGTCTGCTGCGAGTGCTCCGGCGGCTGCGTCAATGGCTTCGAAATCACTACGCACACTATACAAGCGGTACTGGCCAAAGATTGTCAATGCGATGGCAGC
ATTGGAAGTTTACATGCCAAACTCGGTGACCCTGGTCAACACAATTGATGGAAGCATTCCTAAATGGTCATCGGTGCTGTTGTCATGTGCGATTTTCCAT
GTCAACACGAACGCTCGCGATCGAATGGAGGACGATACGGAGCTACCGGCCGTTCTCCGCAGCATTCCGTTGCTACTGAGAGCTTCGGCTGAAAATCCGC
TCAAAAAAAGTGGCCCTTCATCTAATAGTTTCCCGGTGCTTCTAACGACTGCACTGAATACTTTGATGCTCGCCAGTAAACGGTGCGCTGGCCCAGCTCA
GATCGAGGCCCTGGAGGCTATTTTCTCGTGTCTATCGCGTGAAAATCTAGCATTTGCTCGGGAAATGTGCCGCTCGGCTGAGGATGGCGAGCATCTCAGT
GCTGTACTTTTCGATGTCGTGGCGCAAGCGGGGTTGTGTCCTACCGAGGTGGTTTGCCAGCTTTGTGACGCAACCGAGCAAACTCGGCATGCTCGAGCGG
TGAGTATCGGGAGCAAAGGTACAAAATCCCGCCGTAGTTCTGTTGCAAGTAGCGAGGATGCCAAGCACATGGTGGAGGTTGTGCAGCTCGCTACCACTGG
TATTGTGCTGCTGCATACGACAGAAGAAGCTCGAAGCGGGGTGGTGCGCTCGGTAGCCTTGGTGCAGCAGGCCATTTGCTCTGTTGCTGGTGGGTACCAT
TCTCCTTCGGTAAAGGGAGCTGTGGCAAAGCTATGTCGCGCTTCCACTGAGTCAGTGCTTGCGCTGGCACGCACGCTTGAAGCAAATAACGACTCCAGCG
ACGAGGTGCTGACCGGTATCAAGTCAACCATAAGCAGTTCCTTCGAGTTCCTCGCCGAGTGGCTTAAGGAAGACATTCGTAGTGCCCCAGAGTTTGCTAT
GCAAATTGCGGCGAACTATGTTGCGAACTTTCCGGTGTGTCTCCAGGGTGATGCAGGGCGCTTCCACGCTGATGTTGCAGAAACAACCTCAGCAATATTG
GAGCTCGCATCCGCGAAGGAAGATGATGAAGCTACGAATCAGCAACATGCCTCATATAATGCAGAGCTGTTGCGAGGCTTGCATGCAGTCGTGAAAAAGC
TCGTCGATGTGCACCAGAACTCCATTGCGAATCGGTATCTGGTGTCGCTCGGTCCTTCTCTTGTGGAGATTGTCGGTACAGCAAACGGCTACCCAGGGAC
AGCCGCGGAACTTGCTGAGCTGGATGAGGCAGAGGGGCTTCTTCGTCTGCTAACGTCGCAGCTAAACGACCACCATGGGGCCGCGTTTGTACACATGCTA
CTTCCTAGATTGGCAGAGGTGCTCAATCATCAAGCTCCATCTGCGACTGAAAATGTGATTCATGCGCAAGTCCCCGCATCCTGGCACGGCTGCTTCTATG
TTTTGCACAGACTCACGCAACAGCGTTCAAGGAAGCGGTGGCAGCCATGGTGCCTACATTGCGAGGCGTCCTAGAGAATGCGCTACGACTTGCTCTCACA
GGCTCGGCGCAGCCACGGGGTCACTCCAGTCATCGGCCCCTGCCGCTACCAAACTTGACCTGAGTCGGTTCGGTTAAACAATGACTCGATCCAGATCAAG
AATGTTTCAATGTTTCAATGGATCCAAAAACAACAAATATATGTCCGTAGGTTAGTGCTACGTGCGCTAAGGAGCACCTTGAGTGCTCAGTGTGGTATGC
ATGGGGCAGTCTCACAAGTCGTCGAAGTTTCGTTGGTGGTCTTCGACATGACGCGATTAGATGTTCGTCGTATACACTCAAAGTGTCATCTCCGGACGCG
AAGTCGTTGCAACGTCTTGGACTGCCAGTAGCTCCAGCAGGCTGAACAACACTGTGTGCACGAGGTCCATGCTGTACAACTGATAAAGAACACAAACTAT
CAAGTTAGCCCACGCAATTCAGCCTCCTCAGCTCATGCTAACCCCACCTCCACGCCTCCGTCCAGGTCAACAGCCAATTCTTGCATTTCAACTCGCTCGA
TCTCGTAGGTAGACAAGTCAAAAGGCAGCGCGTCAACGTACAGGCGCTCCGTCAACTCAATGAGCTCTAAAATGAACCATACCAGCACATACCAACATAA
GTTCTTGCACACAATGCAGCTACGCGACCTCGCGTACCTGGAACATACGCGGACGGGCGATTGCCTCCCGGTCCGTCTTTAGTCTGCTCAAACAGTCGAC
GCAGCGTCGCCCAGGGCACCGTGAGTGTGTACGACCGCACGATGTCCTCTTTCTTTGTAGCACGGTACTTGAGCAGCAGCGGCGCTCGCGGCGGTTCCTG
CGTCGCCATCGAACTATGCTCTCCTTCCTCTTCTATCTGGTTGTTCGTCTCCTGCTGGATCCTCTTCGGTCTCGGCTTCTGAGCTAGCAAACTAGCGACC
ACCCAGTTCCGCGCCAAGCGCTTCAAGTTGAGCTGCTGGATGTGCACCACATGAGTGCTCACGACGCATTGGAAGCGCCGCTGCAGCCAGGAGCAAACCC
AGCGCAACAGTTCTTCGTGTCCTCGTAGCAGGAGCACCTGCTGTCTCTCGCGCCCTTTGCGCGGCGCTCGTTGCTCCTCCTCCTTGGGGAAGTAGAGCAC
AAAGCCGCCCGTGCGTTCGGGCGCGTTGGACTCCGCTGCTTTACTTGTCTTGGTGGCTCTGCTGCGGCGTCGGTCGCGCTCCTCTCGGATCTGGAAGGCC
ACGAACGTGTCCGTATTGCGGATGCTCACGCTGTAGCCGAGCTGTGGCCGCACGCCCGCAGTGCCGCGGCGCGCAGCGTCTTGACTAGGTCGTGCGCGTA
GTCACTGAGCTGCTCGCGCTGGAAGTGGAAGAGCGGCGATGCGCAGTGGAAGACCCAGCGGCGGTCCAGCAGCACTTGCTCCATGCTCACGCGCTCGCGT
TCGCGGCGCGCTGCGGCCTGGCGGGGCGTCTCTTCCTGCGGTGCTTCGTCGCCGTCCTCGGGCACGCGCGTGTACTGCGACGGGCGCATGGGTGAGCTGT
AGGCTGCGCGGAGCTTCTGCTGCTGCTGGGGCGTGACGCGCGGCTCTGGGCGCGAGTTGTCCATGGCGTCGTCCTGACTAATGGGGCAGCAGAGCGTCAT
GGTGTCGTAACGGTTTATGAAGGACGCGGTGATTGGGGTAAAATCGATTAGTAGAATTTTTGATAGTGGACGGCGTCGGTCAAGCTGCTGACGTCAGTGG
AGAACCACCTAGCGTCTGTGACTTAATTGCTCCGGAGGAACGCAGTGGACTGGACTAGACACGCGGTGGCTTACCCACCCGCCAGGAGGAGGAAGATGAG
GATCACTACCAGCACCAGGATCGTGATGTACAGCTTGGTGTTGTTGCTTTGCTTGGCCACCTGGTCAAAGAGCGTGTCAACACGACTGCAACGTAACATC
AAGCAGGATTCGTCAGCGACGTACCCGTGCGGCGCGCGCGGACTCCGACTCGAGGCCGTCCGTGACGCGGGACACATCGTCGTCCATCTCGTTCAGCAAT
CGCACGTGCAGATCCGTCTCGTCCTTCACCGTGAGACTGTAGTTGTGCAGGTTGGACACGCCCTGGCCGATCAAGTCGAGCTGCTGGTCCTGGTCCTTCA
TGATCTGGTTCTGCATGCTCAGCAGCCTCGCCGGCGCGTCGGCCGCCCCAGGACTGCAGCCAAAGAGAGAGAGAGAGAGATGAGCACCAAAGACTGCCAA
CTAGGAGTTCTACAGGCCGCACCTCACTGCGGCGCGTGAGGTCTTGCGGCTGTTGTACATCTCCAGGTCCTCCTTCTGGTCCTGCGCTAACTGGCCCAGC
AGTCGCTCCCGCCGCTCGATCTCCTGCTGCGTCCTGCCCAGCAGCAACAGCACAACACCCAAATAGTGAGCCTTTATCCAGGAAGTGATGCCAATCCGAC
GTAGATTTTTTAGCGTACACGGAGGTGCTGGACGAGCGCTTGAGTTGGTCGAAGTCCCGTTTGAGACGCGAGACGCTCTGCTGCAACGCGAAGACGCTGG
TGCCGATGGTCCCCGCATTTCCCGCGCGGATTTTGCTGGACAGCACCTGCTCCTGACCGCGCGCGCTCTCCAGCCGGTCCAGCCACGACGCCCACGCCGT
CGCGCTCATAGTCGGAAGAAGGCTCGGAATCTGAGAAATCTTTCTAGCTTGTAGAGCGACCGTAAAGTCGAGATGTCTTTGAACAGGTTTCGCATTTAAG
AGCATTGATGCGAGCCCACCCATTATTCAAGAGAGGCTCAGCAGACGACGACCATGAGCCAGCGGGAGTTCGAGCGCAAGATGGAGGAGCACATCGAGGA
GATGCGCGTGACGCAGACGATCGCGTACTTCAGCCGCACAGTGGAGCTGTGCTTCTCGGACTGTGTGCACGCCTTCCGCAGCAAGAAGCTGGACGACAAG
GAGACGTCCTGCGTCAACAACTGCGCCGAGAAGTTCCTGCGCCACACCATGCGCTCGTCCGTGCGTCTGCAGGAGAGCTACGCCGAGATCATGGAGCAGC
AGCAGGAGCAGCAGAAGTAGAGCCAGAAAATCGCGGGCAGACCAGGCACGCGTTGATGCAGCTTTACTAAGACACCTAATCGAGACTCGCGCAACGGCGC
TTCAAGCCCGCCTTTGCATTGAGTTTTGAGATCGCTGTTAAAGGGCATGTAACACTACCGCAGCTATGAAGCAGAAGTGGGCAAGGTGCTGTTGTGCCGA
CTGCGTACACCTTGCTGCTGCTGGTAGTATAGAGCACTAAAACCAAAATTATACATTTTATGCAAACTCCAGACCCAATTCGTGGCAAAATCCCCAAAAA
ATGGCGTCGTCGTCCCCAAGCGACAAGCTGCGAACCTCGTCGGATGACGGTGACGCGACCGCGGCCCGGGGCTTCTCGAAGCGCGGCGACGGCTTCTCGG
TGCAGGAGACGGAGGGCTTGCTGCAGGAGGTGCGCGACCGCTGGCAGGAGGGCTGGGAGGTGATCACCGAGGTGCACAACGCACAGTTCCCCGGCCACAA
GCGCACGTCCGGATCGCTCAAGCGCAAATTCTCCAAGCTGTACCGCATGAAGGTGGACGGGGGCACCAAGGAGAAGCACGCACGTGCCGCGGCCCTGGCC
AAGAAAGTACGCGAGGAGATGCGCGCCCAGCGGCGGGGCCTGGGCGTGCGCGGACTCAGCGAGGACCTCCCAGGGGGGACCGATGGCGTCCAGGACGTCC
ACGAGGAGCTCAGCGAAGTGGAGATAATCACGGCCCAGTCCACGCAGGGGCAGGCGCTAGTGGATGCTGCCACGGAGCACGATCTGGGGCAGTTGACGCA
GGGGACGGGGCTGCGCGACGATGCGTGGCAGGCAGCTATTAACCGCTGGCCCATTGCTGGAGAGCGACTGCGCACCTTGCGGACTCAGATCGCGAGCAAT
GAGCCGGCATCGAGTCAGGACCTGGTGCAGACTGTGCTGTTGGTGCTGCTGGAGTCGCAGCACCAACGGGACTTGGAGCGGGAACAGGAGCGCGAGGATC
GTCGGTTGGAAAAGCAGCGCTGGCTGGAAGAAATACGCGAGCAGCACCGCCGACACGAGCAGGAGCGTGTGGAGGATCGCCGCAGGAACGAACAGTTCAT
GCAGGTCATGACGACGGTCATGGCACAGCTTGCGCAACAGCAGCGAGGCGGCTTGAACTGA