Description :
From Genome Similarity Track
Location :
Scaffold_1935:1206- 3411
Sequence
2205 bases(100 bases per row)
CACCATCAATGCGATCGGAGAGGCCCAAGCAAGCAGACTTTATAGATCGAGCTAGTGAACATGCCTCTTTCATCAAAGTTACATGCAGCACTGCCTGACA
AACTGTATCAAGAATACCTGGGACGTCTGCCATCTTCTTGAAAGCGATGCCAGCTCTTTCTTGTTAGAGCATGTCAGTGTACCGTTAGTAAGCTCAGGAA
GTCAACTTCTTCGATACCGGTATATTGAGGATCAACGACGTTGAAATCTGACCTGACTATCTTTGGGGAGGTCTCGTCCACAGCTGAGCCGTGGTCATCT
AGCTGCTGTTGGTGGTGGCAGCGGACGCGGAGGGCTGTGGCCGCAAAAGCCTTGCCTTGGGTGGAGGCTAACTCTGGGGGTTGTCCACCAGAGAAGCCTA
CTAATTTCTAGTTTTCGTTGGCCTCTAGTGCGATTTTCGAAATGGACAGAGTAAACCAAGGCTACAGTGTCCACTCCAGGCTACTCTCCACATGCTCATG
ATGCACAGCCAAAAGTTTGCGGTCATTTGTTGTGGATCCTTTCGTAAGCTCTCGGTACAAAAGCTACAACTTCGCAGAGTCCGGTATATGAGGAGCAAAC
TGATGTTCAGAGCGGAGGCAAAGCTGTGGGTCACGGAACAAGATATTACACGCAGCAGACAGCTCCGAAAGCGGAATCGCAAAGCGTTCGAAGAGATCAT
TTCGCACTTTTGGAGCTCTGGAGGTATCAAGAAGAGCTCCCAAAACGCGAAATGAGAGGTCAAACGAACTTAGAAAGCGAACTTAGATTTGAGCACGCAC
CTACTGCCCCTCTCAAGATCAGCGCACTTGCTGTTGGCAGCGAAAATTGACAGGAGATTTATATCAGTGCTACCTTCTGAAACAATTCTTTCGTGCTTGG
CTTTGCAAAGTACGCCTAGTTGACCAGGGCAGGTGATGCAAGCACACACTGTAAGCTCAACCTTGGGAACTTTGAAGCGGTCATTTTTTTCTATAGGTGG
TCTGTCCGTTGTTGGCCCCTTCGGCTTTTTCTCACCGAGCTTTTCATGTTTTGTCAGTAGCACTTGTCCTGATCGTCCTCACAAAAGGACAACCGCGCTG
GCTCCTTTTTGTTGGTACCCATCCTTGTCGCGCAGCATTGGTCAAAAGTGACCTCATTGGCAAAAACTGATTTCTGTAACGTGTTTGATTGGTTGAAAGT
AACGACTTCAACTCTTTGATTGGTCACAAATCGGACACGCAGCTGCTCATCAAGTGTCCGACCTCTATACCGAACCTCCAGCGCTCCATGCGAACCTACA
CATTCCCCATAGACAACAACAGTACCATCACTAATAAAGAGGCTCAAAGACCTCTTTACATCCACTCCCGTTGTTCGTCGTCGCTTTGCAACCGCTTTCT
TTTGGGAGAGACGGCCTTCTGGCTTGTTTTTCACCCCTCGCAAGAAGGGGGAGCGAGCGTCTTGTCGTGTTTCTATACTTTATTCAAGTGAAAAACGCTC
GCGGGCGTCCCTCCGCCCAGCTGTCTTTGCCGCTTTTCCCCCTTTTTGCCACCACAACAAGGGAAGCACGAGCACGAGCGAGCAGCTCATTCAGTAGGTT
GCGAGCACGAGACGCTCTCTCTCGCTCTGTTAGCAGCCATGGCGGACGACCTCACCAGCACCAGCGGCACTGGCAATGAAGGCGGCCTCGTGGACGGCAG
CGCCAGCGTCTGGGTGCCGCACGATCAGCTCGTGTGGAAGCGCGCGGTCGTGCTGCGCAAGCTCGACGACGGCAAGCGCGCCGAGGTGCGCCTCGAGGCC
AACAGCGACGGCGAGTACCACAAGGACGACGGGCTCGTCAAGGTCGTGAGCATCGCCGAAATCTCCCGCCTCGCAGGTGTGTACTTCGGTGTCGTCTTTT
CCTGTCTGTATGTGTTCTTAACATGTTCCTCCTCCCTCTCTCTTATCCTATGAACTATAGGCGAGGTCTCGGACCAGGCCATGCCGATCTGCAACACGTT
CACGGGTGCAGGCGTCGACGACATGGCGACGCTCAATCACCTGCACGAGCCGGCGCTGCTGCGCAACCTCGAACTGCGCTTTGCCAAGCAGATGCCGTAC
ACCTACACTGGCCAGATCTGTGTCGCTGTGAACCCGTACCAGTGGCTAGACCTCTACGGAACGGTACGTCGAACGCTGTCGTTTTGATGCGTCAAGGTGA
AACAA