Description :
From Genome Similarity Track
Location :
Scaffold_1059:1206- 3409
Sequence
2203 bases(100 bases per row)
TCGTCTTTGTGTTGCAGATCCACAGTATCGCTTTGTCGATCGGATAAAAGGAGCACTGTGTTTTACACGTTGTCACTTTCGTACTCGTAATCCTTGTCAT
TCTCTCCGTCGAGGTGCTCACTTTCATCTGGTAAAGACTTCTCGCGACGGTCGAAAATCCTATCAGAACTTTGTGAATTGCACCCTGTGCGATCTCTGCG
GGGGTCCTCATCACTTATTGGTGCAAGATCCTCCTCAGCAGCCTTCTCCTCACTGTCAGCACTTCTTTGTCGACGCCGCGCTCGCCATGGTTGGTGGTGT
GTTATTTCTCCAGAGATGACATCACTATCGCTCGATGACGGGGTGATAGAGATCGAAGACGGTGGCCCTGAGGCACGACCGCTGTCATGCCGCTCTCGCA
GATGCGAGGTGTGCGTAGCCAAACGTCGATGACCTTAAAGTATCCCCATGCTATGGTGTGGGCTTACATCAGCATCGATTTGTGGATCCAGTTAGCAGTA
GAATTGAGATAATTTGTTTTGGTTGCAGTGGTTGATGGTGGGGTAGATTGCTTGTCGAGAAATGAGGTAAAGCATATTTGTCGAGATTGAATATTTAAAT
TTGTACTCTTGGCGCCTGCGGCATAGGGCAGTCGCTTTTAGTCGTACAACGTCCAAATGTCAGCCTTCTACAAAAGACAAAAAGTAACAGTTTGGGTCTG
AAATAAATTAAGTTTCAAACATTAGAGAAGTAAAAATAAAGAATTTATTCTTTTTTTTACGCACGTGGACCCTTTTAGTATTAGTCACTATATTACGTCA
GGTCCACCGGATTGCTTAAAGATCCATCCGTTTCGATAACGACGTCTTCCTCATCATCAGCTTGGTAGGATTCCTCCGTGAGTTTCATAATCCGACCCAC
TCTCTTCTGATTCGCTAGAGCTACTGTCGAAAGGGTCGTCAATATCCGGAGTTGATGGACCGTCTGTATCTGAGTTAGTGCCGTCTAATTCGTCAAAATA
AGTACCACTCTGTTCCATCTCAAATCGAACACTTCTCCTTTGCTGACATATTTATTAAACTAATGGTGTGATTTAGCTAAACGAGCCCACTACGGAAAGC
CCTGCCTATAAAGCAGTATTTTTTTGGTAGATCATAGTCAAACAGCAACGAAGTACAGAGCAAAAGAGCGTCATTCGTTTTGACGGGGTGGACGTCTGGT
TTCGCAGTGGGCTTCCCAGTGTTGGAAAATTGCTGAGGTTTTCAGAAGAGATCGATTTTGCTACGGTCTTACAAGATGTGAAAATAGTTCTTCAAAAGCT
GCTGTCTGTGCCGCGTTTGCCTGAAAAACGCTTTTGACCAATTACATCTATGTATTTACAATCTGACAAATTTTGGATCTCGCAAAAGGTGAAAATAAAT
AAAACAAGGTGTGTAGAAAAGAGTTCATCATAAAATAAAAGATACTAATTTTGAGTTGGTGGCCCTTCATTTTATTAAGTGTCTCCTGGCCCTTTTTGCC
AAAGGGTCGCAATTGGAAGCACTCCGTTGCGAATGTGGTGCTTCGAAACTCGGGGCAGTTTGTATGTATCACACGCAATGACAGATTCTGGTATTTTTTG
TGCTGTCAAAAAGCACTTATCTATAGTCGATCACAGTAAGTTTTTTCAGCTTCCGCAATTAAAGCATCGATCTTGTACGTTGGTGTGCGGTATTGGAGCC
GGACTGTAGCAGAGTTAACAAGACCCATTTCGAGTACGATCATATCGGGCGACTTAGCTGGCTGGTATTTGATAGCCAATGTTGACAACATCAACATTTG
TTGTGCCTGCCGTTAGAGCGATCAGATGGCAGCACTTCATGCTTACTGTATCTGCACCAGCTACATAATACGTGTCAGCTGTAGCCACAAATTAAACAAC
CCCCCAAATCTCTATTCTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN