Description :
From Genome Similarity Track
Location :
Scaffold_1702:1206- 2921
Sequence
1715 bases(100 bases per row)
TTGAACCATCTTGAAGCGGTTCTCGCGCTTGCGCTGGAGGAGATAGTCGAATAGTAGTCCTCCGCACGATAAATTCGATACTGGTTCCCAAGTCGGCTCA
TCGTATCCTTGCCACTGGACGTAGAACTCTCGCTGGGTCCGCTCCGTGCCTGTCGAAATTGGCCATCGGTCGTCGAGGATAGCTTCGACGATGTACTTGT
CACCGTCTCCTTCCGGCTCCCAGCTGTCCTCCGGCAGAAGTTCCTCATCGAAATCAAACCTCTCATCCTCGCCGAGTCCGTCGATCAGCTCTGCAGTCGG
TCTGCGGTCATCTTCGCTCACTGCCTTGAGTCTGGACACGTGCACCACAGGATGGAAGCGGTAACCGGCCTTGTCAGGTAGTTCTAGCTCGTAGGCAAAC
TCCTCCACCTCCCGCTTGATGCGGAAAGGGCCATGCCACCTGTGAGCGAGCTTCTTGGTCAAGCCGGGCTTCACGCGCTCCATAAACAACCATACCCGGC
TTCCTGGCTGGAACAGTGAGCGATGGACTGGTTTTCCTGTTGATTCGTCGACCGTTGCTTTGCCAGGATCGCCACGTTCGTCGAGCGGTACAGCAAGCCT
TTCGATTCTTCCTAGGACTTCGTTGTGTTCTTTCGCTCGCCGAGCCTTTTCGGTGGCTTGGTAGTGTTTCGCCATTGCCAGAGCAATTTCGTGTTGTCGG
TTGGCCTCGCGTCTCCAGGCTGCATCGTCCGTCTGATCACCATCGCCGAGCCTCAACGAGCTTGTCATTGCCTTGAGTGTCGATTGGGCATCCCATCCGT
GGGCGAGGAAGAATGGTGTCTCCTTCCTCGTTGTGTCCATCGAATTATTGATCGCGTACACCATCTTCTCAGCGATCTCGTCCCAGTCCTGCTGGAGTGG
GTCTTCGACGTACACGTTCACGGCTTGGATCACCGACTTGACAGACCGCTCCTGCTGACCGTTCGCTTGGGGCCGGTAGCTGAGCGTCGCTCTAGACCTC
GACTGGATCAGCTCGAAGAATGCCTTGAAGGTCTCACTCATAAAGCGTGGATCGCGATCGTGTCGTGGGCACCAAAGCGTCGGAACACATATTCCTCGAA
AACATCTGCAACGTCTTGTGCCTTGGTGCTGCTCATGGCTTTGGCGATAACGTAGCCAGTGAAGGAACACTGGAACAGCAACATAGACGTGTTGCCTCGC
CGAGTCTTCGGCAGCGGCGTCACCAAGTCCATCGATACCAGCTGGAACGGGCGGTCGGCGAGCACATTGCCCGGCGACTACCCCTTCAATTGGGGTTTGC
CCTTGCTGGTACTGCAGTCTGCGCATGCGCACACATGGCGAGCCACCGTGGCGTACAGTCCAATCCAGTAGTAATCTTTCTTGACCTGGTGGAACGTGCG
CGTTATCCCTTGATGCCCTCCTTCGATCGAGTCGTGACAACTCTGCAGGACTTCTTCAATCATCGTCGTCGGTATCACCAGTCTCAGCTGAGGTTCCGGC
TCGCCACCCTCGTCGAGCTTGCGTCCCTTACCCACATAGTGTCATAGTGTGGCACGTCGTCTCCGTCCAGGACGAATCGGTCGGCGAGTTTGCTCGCATT
GGCTGCCCTTTTGAAGTCGAGGGACTCAATGTCACCCCGGAGGTACGGCCCACCTCCTTTCTTCGTCTTGGGCAATGCAGACTCGCCGTATGCGTTCTGC
TTGCACCGCTACCGG