Description :
From Genome Similarity Track
Location :
Scaffold_3503:1206- 2210
Sequence
1004 bases(100 bases per row)
AGATTCAACTTGGGAACCATCATCCAACTTGTCATGTGGAGGTCTGCTGTACGACTATTTGCGAGCCAAGAAGAGCGAGAATCGGCTGCAGATGGCGCGA
GTGGCGGACGAAGACTAGCGTGACTGGATCACGTGTGAACTGTCCACAGGGCGATGCAGCCTGTGGTAACAGACGAAAAACGTTACTGCAACAACAAATT
GTATGTGCATTTGAAGAACAACATGAACATGATTACGCTGTGGAAGTGGATTTAGAATAAGAAAACATGAATGCCGACCGGAGAGCAACCACTGAAAACG
AAGTCACGCGGGGACACCTCAACAGTTAGCTGACATGCTGGAGAACGTCGTGGAACGTGCAGCGAGGATTCAAATCGATTCCAAGTGCCTGGGCCGCGGT
GGCAAGAGTGTCAACGAAGTCGAGTCACCACTCTCCTTCTCCTCTTCATCAGAAACCCGGAGCCTCGGCAGCTGGAGCTGAAGCCGGACCCTGCGAATCC
TCGGTACCAGCTTCAACAGGAGGAGCAGCAGGAGCCATCTCCGCGGATTCAGCGACGACGGGGAGTGCTGCAGGAGCTACCAGAGGAAGTGAAGAGTCTG
GGGCAGCAGGCGCTGGAGGGCCGGTTGATGACGCTGCTGTCGGAGGAAGTGCAGCAGACTGAGCCGAGTGTGTCTGTCATGTGACCACTCTCATCAATAT
GACTCCTAGCTCCAAGACGGATGGACGAGCCCCGTATGAGCTTTGGCACAACCGTATTCCATCCATGCAGTACATCAAAGTATTCGGATGCAGCGGATAT
GTCCACATCACGGAGCAATACCGAGACAAACTCGACGCTAGAGCCCGTTTGTGTATGTATCTTGGTGTGCCTGACCATAAGAAAGGCTACCGTCTGATGG
ACATCAATACTCATGCAATTATCTACAGTCGTGATGTAGTCTTTAAAGAGGACGAATTTCCCTCTCTCACAGGCCTGACGTCTACTCCAGAGCCCACACA
GTCC