Description :
From Genome Similarity Track
Location :
Scaffold_16:1205760- 1206762
Transcript NameFunction/comments
Phyin_T30-4PITG_08836Putative uncharacterized protein
Phyin_T30-4PITG_08837Interferon-induced GTP-binding protein Mx

Sequence
1002 bases(100 bases per row)
AGATCCACTCATGGCTACACGCTCTGAACGACTGGTTTATGGACATTCAAGAGCAGTATCCGTACCGTGTAGCCGTGAAACCTTTGGACGACGCTATACA
CGACTTAATTTACCTGAAACAAGACGAGGAAGACGTGTGGGTGGAGCCAGTGTGGCCTGGTAGTCATCGAGAAGTTGAGGCAACTCTAACGAGCTCTCCA
GTACCGCCATCGCCACCTCAGTCAGCGTGGGGAACGACTGCGATCCCAACGTTGTCGTTATTTCCTAGCACACCCTTTCTGACAATGGAGCAGAAATTGG
AGCAGCAAATGAGGCTGGAAGATGAGCGGAAAGATCTACGCGAACGTCTGCGTAAGAACCAGGAGGCACTGGATGCTCTCGAGTTGGAATCGTGGTCGAT
GCAGATTCTGCAACAGCAAGAACTGGCGCGAGTGGCGCAGCAGGCGAGTGACAAGCAACTGGCGATTCACATGGCTGAAGAAGAAGAACTGCAACTTAAG
TTGCTGCAAGAGTACGAAACAGCGCAAGAAGAAGAACCCTGGAGCTGGACTTAATGCCTGGTACTTATTTTTCTTATTTTTCTTAGTTTTTTTTATATTT
GTTGGAGGTATCGCTTGTGCACGTTGAGTTAAGTGCACGTCACCTTTTTCTTGATTTATCGACCTACGTTTTGGGTCAACGTGCGTCAATTTCCTCTTCA
TCAAATGCAAGTCACTTTTCTTAAAGTATAATAACCCTCTTAACTTTTAACGCTATCCATGAAGATCAACGGGTTGTTGGCGCGGGCTCGTAGCTGTGAG
GAAGAGCGCAGAGTGATCGACCAGCTTCGTGATGTTGGGCTGGATCAGTACATCGAGTTGCCTCAGATTGCAGTTATGGGAGACACGTCCAGTGGCAAGT
CGTCCCTACTTTCCGCACTCTCGGGTGTATCCTTCCCGTCGAACGACCAACTCACGACGAGATGCCCCACCCAACTCATTCTGACCCGCGCCGACACTTT
CC