Description :
From Genome Similarity Track
Location :
contig_82:120575- 123596
Transcript NameFunction/comments
g12651.t1hypothetical protein
g12652.t1hypothetical protein

Sequence
3021 bases(100 bases per row)
AGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGCCTGGCTATCCAAGAAGGCAAGTGGATCCATC
GCCTGCTGTGCGAGATTCTGGCGGCTGCCACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAAACCCGGT
GAACCACGGCCGCGCCAAGCACATCGACACAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGA
TGCTGGCGGACATCATGACCAAGGCACTTGCGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTG
AGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGAT
TACGCCACTGTCGATTACGCTACCTGTGGGTACAAGATTGTAGACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCAGT
AAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCTC
AAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCACTCCG
CTCCGTCAAGCTTCACGGTGTCAAGATCCATACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATC
GACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGC
CGAGCTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGT
GGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGACGCGCCTGAAGACGCTGTACGGTGGTCGCAGAAGCTGGTCGCATCTACCTGAAGCGCCAACTCTTC
AGCATGGAGATGTCGGAAGGCGGGAACGTGTTGCATCACTGCAACGAGGTCCTCAACATCAGCGCCAAGCTCAGCAGCATCGGCGCCAAGATGGAGACGA
GGACGTGGCGATCTGCCTGTGCGCAGTCTCCCCAAGAGCTACGAGAACGTCGTGCTGAACTTGGAGATGAGCAGCGCGGAGCTGCGATCGCAAGACGTCG
TGAAGGTGCTGACGAATGAGCACATCAAGCGGCAAGGCGAGAAGACGGCGACGGTGAAGACGGAGGACGCGGCCAAGGCGTTCAACACCGACCGAGAGTC
TCGCCAGTGCACGTACTGCGGGAAATTGGGGCACACGATCAACAAGTGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGACGCGGCGGCAATGGC
AATGGCCGTGGACGCGGGGCCAACAATGCCCAGTGGAGGAACGACGACGCCAACTACGACTACGGCTACGGCTATGATCGAGTGGCGTTCGCGGTCTCAC
TGGAGTGTGGCATTTCGACGGGCAAGGATATGCTCGGCATGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAAGGCCAAGTTCGCCCA
TTTGATTGAGCGAAACGAGGGCGAACTTTCGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGAACCATCGTGGAACGAGTGGTTCTGCCCAAC
GGCGACGAGCGCGACATCGAGATCAAGAACGCGCTGTACGTGCCGAGCATGAGCAAGAATCTGCTCTCCGTGCCACAGATCAACAAGAGTGGTCTGTTCC
AAGTCGTGTTCGACGGCGCCCAGATGCGCGTTGCGCACAAGGCCTCCAAGCAAGTGGTGGCGGCGGCGAACCTCGTGGATGGCCTCTACTGGATCCAGAC
GCCTCAGCGATCGGCGAATGCAGCGACCAGTGGGAAGACGGTCGACCTGCACGCGCGTATGGGTCACGCTCCGGTGGAGGTGCTTCGCAAGATGATCGAC
AACGACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGTCAGCAAGGGAAAATGGTCCAGAAGCCGTTCCCAA
GCAACCGTGACAAGCGCCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCTCTGGTGGCAGCAAGTATCTGCTGCT
GATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACG
CAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGC
AAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTT
GGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAGGGAGCACAAGACTCCATTCGAGATCGTGTA
CAAGTCCAACCAAGTGTCAAGCACATGCGTGTGTTCCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAAGGCTCGC
GCCGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGTCGCGATGTCAACTTCGATGA
GTCGGCCTTTGGACTTTCGGC