Description :
From Genome Similarity Track
Location :
Scaffold_4:1205624- 1206784
Transcript NameFunction/comments
Phyin_T30-4PITG_03256ATP-binding Cassette (ABC) Superfamily

Sequence
1160 bases(100 bases per row)
TCAATCTCGATCATTCTAAAACTTCCTTGCTCCGACTCAAGCATTTACGCTCTTTTCTGATCGCCGAAAACTTCAATGCAGCTATTTGCCCCGCTCCTTG
TAGCCTGTGCTTTCGTCTCCTCAGCGGTCGTAGCCAAATCTGGCGAAGAAACGAAGTCCCTTGACGAACTCTACGCTGATGCTGTCGTTGAAGGCGGCAA
CCTGGTCCTGTACCACGGAGGTGACACTCCTACGCAGCAAAACGGTCTACACGAAGCATTCTCGCAGCGTTTCCCGAAAATCAACTTTACTGTCATCGTC
GACTACAGCAAGTACCACGACGTGCGCATTGACAACTAATTAGCGACTGATACGCTTGTGCCTGATGTGGTGGCGCTCCAGACGCTTCAGGACTTCACTC
GTTGGGCTAAGACGGGTAATCTTCTCCGTTACAAACCCGCCAACTTTTCAAAGATACCCGATTCTCTTAAGGACAAGAACGGCGCGTGGCTTGCGTACAC
TATTTTCACGTTTGGCTACATCTTCAACTCGACTGCAATCAACGGCGTTGCACCGCCTGCTACTCCAGCAGATCTGACGAGCCCGCAGTGGGCTGGCAAG
ATCGCTTCGTCGTACCCTCACGATGACGATGCCGTGCTTTTCCTTTACACTCGCTACGTCGAGAAGTACGGATGGGATTGGGTGGCTAGGATGGCACAGC
AGAACATCAAGTTTAGCCGTGGATCGAATGTTGCGGGCGAGCTCGTCAGCTCTGGGGAGAAGTTGATTGGTGTGGGCACTGGTGGGGGCGGCGCTCCGAT
CGAGTTTGTGGGCGGCAACGGTACGGACTATTTGAGCTGGGGTCAGCGTGTCGGTATTCTGTCCAAGGCTAAGCACCCTGCTGCCGCCAAGCTGTTCATG
AACTGGGCTATTTCACAGGAAGCCCCGACGACAGTGGTTTTCAACAGTGTACGAACGGACATCAACGCTAACAAGCCTTGGAATATCCCCGAAGCGAATA
TGGCAGCTTTTCCGAAGTTCATGGAGGATCGCGCCAAGGTGGAGCAATGGAAACAGACCTTTGCTCTGTACTTTGGCGAGGTGCAGGGAGAGCCCAGTCC
TGGGGTCCTTGGACTTCACCCTGGTCTTTAATGGGTTTCTCTGTAGTAGTTGCAGCTTAC