Description :
From Genome Similarity Track
Location :
Scaffold_61:12048- 13411
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16944hypothetical protein

Sequence
1363 bases(100 bases per row)
AGCTCACATTGAGCTGAGCATTGAGCTCCAAATGGCCGCCCTGGCGCGAAATGGGTACCCATAACACCAGGGAACCGCCGCCCGAGCCAGGGAGACCGAG
AAATCCCGGACGCCAGCGGTCTAGATACAGCGTTTTGCCACCAAGCGCTGTAATATTTGATCTCCACTGGGCGGTCCCCCCAGCCTTGAGCTTGACTTCG
TCGATTTTGTCACCACCGGACTTGATATTAACCGTCACGTCCTTGGTATCCTTACTCTTAAAGTTAATAATAACAGCGCCGTCACCTTTCTTGGTCCAAG
ACAGCGTACTGTTCTTGAAGGCCTTGTGAAGCGCACTCATTCCCAGAGTGGCGAGTTCGTTGCCGTCATCGATTTCACCCATGAACTGGGTAGGACCGCA
AATGGTCTGGAGGTATTCTCCAAATAGTGTCGACAAATCAGTGGGTTCCCAACCATATGAAAGTAACGTGAAAGCATTGTCGATCCACACATACGCAGCG
TGCTTCGCGGCCATGGATGAACCGTTGTCGCTCTTGCCGGACTTGATGAGATCGTTGATCATTACAGAGTAGGTCTTGCGGAGCGTATTGCGTGTCTTGT
AGGCGGTGGCCACCGTAGACTCGGAGATCATTTTGGTCATACAGTTGTTGGTCACCGTCGGGATATCGTATAACAGAAGATCCGATTCGCTCAGCTTTAG
ACGTAGCTCGGACTCGCTGATCTTGGGATCCTTCTGTCTGTACTCGTCCACCGTCATCCAGACCTGGTTGGTCAACGTCTTGAGGTCGTCTCCACATGTG
GAGTTCTGCTTCATAGCCGTTACCAGACTTGAGATCTCTCCCTCCGTAATTTGTTCTGCGGCTTCTGTGAAGTTGGCCTTCATCATGAAAGCCTTGAACT
TCTCCCAACTTTCGATAATTTCATCATCGTAGGTGATCACCAGCTGTAGAACCAACTGAGCGGTGCGGATAAGCCGACGTGTTAGCTGGAGACCAGCCGG
AACTTTTCTGCCCGAGCACGCGTAAATCGTAGCTGGAAGATCACTAACGACATAGTTGGTCTGGTACAGCAGTAGTAGAAGTTTTGCTTGTGATGTCTGC
GGCTCCAAAACCATTTGGTTGCGGGTGAAACGCACGACAGCTCTCACAAAGACCATCATGTAGTTGGCGCATCTGACAGCCCAGCTAACGTGCTTTCCGT
ACTTGGCCAACTGGCCGAACACGCCAAAGGTGGCCATACTGAAGGCGGACATGGCAACGGCAGAAATCTTGGCAGCGTTCTCACGACCGCAGTCATTGTT
CTGTTGGATGCACTGCATGCCACATTCCACGGGATAATCCATCGGACACTCCGTCCAGCACGT