Description :
From Genome Similarity Track
Location :
Scaffold_94:120417- 164362
Transcript NameFunction/comments
Physo_141113hypothetical protein
Physo_141114hypothetical protein
Physo_141115hypothetical protein
Physo_158283hypothetical protein
Physo_141117hypothetical protein
Physo_141118hypothetical protein
Physo_121598predicted protein
Physo_141121hypothetical protein
Physo_158285hypothetical protein
Physo_109354predicted protein
Physo_141124hypothetical protein
Physo_141125predicted protein
Physo_141126hypothetical protein
Physo_141127ankyrin repeat protein E4_8

Sequence
43945 bases(100 bases per row)
TGCTGAATGGTGTAGCCACTTTCGAGTGGCGGCAGCTCCTGCGGTGGTGGAGCGGAAGACGAGAGCTCGCACTGACGCTGGACACGTGGCCCGAGCCGGA
GATCGACATGGACGAGTGCGTGACACACTACCGAGACGCCAAGCACAACGAGGTCTGCGTCATCAGCAGCTAGAGACTGGAGAAAAGAAATCAATTGACG
TAGTCCATGAACCAGTGAACATCTATGTATCGTTCTATACGAGTTTTCGAGGCTAGCAGTCTGGTTACTTGCCGTCGCGCTTGCGTTTGAGGTTGTTGCG
GCTCTGCATGACGGCGGATCCAGTGCCGTCGGATGACACGACGTCCGTGACAACGTACGGAGCTTGGGCTGGTTCTTGAGCAGAGAGGATGATGTTGCCT
AGGGGCATACTGCTTCGCACCAGTAGGTTGACTCGCTTCAGCACCGAAAGGGGCAGCGGACTCAACACGAACAACTGCCGCTTGTCGGCGTCCACCGCTC
GGATGATGCCCACTCCGACGCACGGGGCGTGCACTGGCTGCAAAACGATCCGCGGCGGTCCGTCACGCTCTTCCTCTACAGGTTTATAGTCGGGGTTGAA
GCAGAGACCCACGACGCAGGCGTTCAGCGAGAACAAGAGCTGGCTGGGAGGCACGGAAGAGCCAGCGAAGGCGACGTCGACCTGGTCGAACGATACCACG
AACGGCGTGAGCTGAGCGTAGGCGCGGTAGATGTCGCCGTCGACGCGGTTCTTCTCTGAAAGCACTTGCAGGTTCTGTAGCAGTGCGCGTGGGAGGCTGC
AAGGCGTGCGCGCCAGGAAGTACGAGTGGAATCGGTAGATCCGCATCTCCTTGGAGCTGCGAGCAGGCTGCGTCACGCCCACGGGATCCCATGGCGGGAC
TCCATGGATACGCCACCGGCCTTCAGTAGGGACGTCAAACTGTTTGTTCTTCGTAGCAGCCAGCATTTGCACGACGTGGTCCGGGTTCGTCTCCTGGATG
ACGTTGCACAGCAGGTCGTGGCCCATACTCTTGATCCATCCGTCCGTGTTAATAACCAACGGGACACGCGCGCGCTGCCGTTTCCTGGGACTTGAGTCGT
CAGACACTTGGCCTCCCCACTTGGCTTCGTACAGACGCAGCAAACTCTTGACTGCCTTCATGTAGTACAGCGGATCATTCCCCGGGTTGGTATTGCCACA
GAAGAAGGACCGGATCGGGTTCTTCATGTGCGAGAATCCCGGTCCAAGCAGCGGCGTCGCCAAGGCGTGGAGCGCCACAAGTCCGGACGGGGTCAGCTCG
CTCTGCCCCAAGTCCGTATCCAGGAAGGCCACAGTCCCGAACTTCGCCAGCAATCTGTTGACTAAATAGCGGCAGAACGTGGACTTGCCCACGCCCTTGC
CTCCGCACACGACGATCTTCTGAGAGACGGGATTCTCCTCCTCCTGCAGACTCGCCTGCAGTCGGTCCACCGTCGTCTGCCAGGGCTCCGTGCACTGCAC
GGTCCGGAACGAGTCCACGACCACGAGCTCCGCCAGCACGCGCTCCTGCGACTTCCAGTCGTGGTGCGACGGGTCGGCGTCTGACGGCGCCGCGCTCGTC
ATGTCGAAGCCTGCCGTGAGGTCTGCCACGTCGCTCTGAAGGTGCTTGGGGACGATCATCTTGAAGCCCGGCAGCACCGCCGGCGGCTTCTCGGGCCGCG
CGTTCTCGTAGAAGCTCGTGACATTCCCGTACGTGAGGGGGGTGGCTCGAAGCACCAGCACAATGGGGAAGTCGTCCACGAGCTGCATGGCCAGTCGGTC
GGCCGCGATCTCCTCGTCCTCATTCAGCGCCTCCGAGGGCAAATTCGGCTCCATAACCTGCAACAGACTGGCGTTGGAGGGTCCGAAGGGCGCCTGGGTC
TCCTCGTTGCCCGGCCGGCCCTCGATCACCAGCAGGTTGTTCCATTTGGGCGAGTGCAGCGAGAAGTAGACGCCCAGCGGCGGCCGGAAGCCCAGCACCT
CGACGTTCCCCTGGAAGACGCGGAACAGAGCCATGCCGGCGCAGTTCACGGACGAAGTCTTCTGCATGCCGAGCGCCACGACATTGCCCGAGCGCACACA
CAGCGCGCGGTACTGCGGCGCGGACGCATCCGCCGCGGGGCCGTAGTGAGACCTGCTCGCCATCGTCAATTGGATGATGCGCTCCCAGTGATTGGCCACG
GATAATTTGAGGTATTTCTCACACGTCACATGGTCTTATTTGAGGAGGTTTTCCCACACGTCACATGTTGCAGTCAGCTTCAACGTGGAAGATCCATGGT
CGTCACTGCAGTGTGTGTAGTGTAAGAGGCTTGGTCCGTGCGAGAGGGGTCTGTTTGTACCCTGGTAGTTTTTGGCGGTGAAGGATATTGACCTGTGCGT
TTGATAAGAGTAAAGTCAACGGTCTTGCACCAAACCACAGAGTGCTCGTTCGCTGGAGATATCTAAAACGCGGCGGGAAATAGCGCGTTGCTCGCTGACG
AAATGCATTTGGAAGTGCTGAGCTCTCGTTTGCGTAGGACCAGAACATCTTTGCGCCTATTCTCGGCTGGCGTCTCCATCTTGAGCCTCGAGGCCTTGAA
GCCGACGGACCTAAATGCAGCCGGCAGGACGTGGAGTTATTTTCGTGGGGGTTGTCTGATGATAACAGACGGCCTCGAGCTGAGCTCTGCGTGCATCCAG
CCAGCCTCGCGTTAGCTTCTGCTTCTGCTTCTGCTTCTGCTTCTGCTCCGACGTCGCGCTAATAGCGGCGCTACAACTTAAAAGCGCCATCGAGACCAGC
CCCGCGGTGTCGGCGACACGAACAGCGAACGTGCCGGCGGGAGCAGGACATGCTGCCGGCGCTCACCACCAAGCCCAAGCAGGCGGTGCGCCAGGTCAAA
GGCTTGACGAATGACTCGATCGACTCGTACTCGAACACGCCGCTAGGAGGCGGCTCGGGGATCGGCGGCGGACTGGTGGCCACGTACGTGGATAACACCG
AGTCCGGCAGCGCGACAGCGCGTGGGTCACCGCTGTCGACCAGTCGATCGACTGTCAACACCGCGCGGACGACAAACGGTAAGCCCGCTAACGAAGACGG
AGCGACGATGGCTCGAGTGGTGCGAGACCGCAAGGCTTCGGGGGAGGAAGAGCTGTCGCTACGTACGGGGGACATCGTCAAGGTGCTGTCCTCAAAGCGC
ACGGGGTACCTCAAATGCGAGGCCGGAGACGAAGTGGGCTACGTGCCGTCCTCCTACTTGGAGTTCCTTGACAGCGCGGCAGACGCAGACAGTGTCAATA
GCAAGGACAATGCGGCGGATGAAGAGGCTCAACGAGCTGCTGAGAAACAGCGCAGGAAGCAGAAGAAGGAGAAGAGAAAGAAGGAAAAACGCGAGGCCAA
CGACGCGAGTGAACCCGAGGAGGCAGCCCCCGTCACAGCTCGATCTCCTCGTAAGGAAGCGACCACCAATGCGGAGGACGAAGGCAATGAATCTCCACGC
AAGAGCAGTAGGAAGAAGAGTAAAAAACACCGTCAAGACCGTGAAGCAGCAGGGGATGAAAGCCAACGAGGGGGAGCTGAGGAGCCGTCGAGCAGTGCCA
GGTCCCGCGCTGCGCCGGAGGACACGGAGCGGTCTCGAAGTAAGAGTAAACACTCCAAGAAGAAGCGTCATCGTGATGTAGATAGCAGTGAGTCGAGTGA
GAGCGATGGAGGCAAGCGTAGTGGCCGACATGGGCGTCGTCGCCGCCATCGTCGTGGATCGAGCGATAGTGATTCCGAGTCAACATCTTCCGACGATTCC
GATGCGAGCTACCGACGGAGACGACGTCGTCGTCGACACCGACACCGACGAAGCTCCAGTGAGGAAGACGCTGAGGACGACAGCGACTACAAGCGGCGCT
CTAGGCGCAGCAAGAAGCGTCGGGACAAGAACGACAACGATTCCGAGCCTGAGGAGGGATCTCGGTCGGCTCGGAAGGCCGAGAAGAAGAAGCAAGCGGC
GACTCTGCAGGAGGTGGAGAAGGGGGTGAGCCAGCTAGACATGAAGTCGGACGAGAAAGCAGCGGAGGCCAAGACCACCGCGTCCAGCAAGAAGGAGGAG
CCCGACCGAGACCGAGGAAAGAAGGACGAGACAGAACGCAGCGAGGGCTCGTCGGAAGGGCGGGCGACCAACGTGTCATCGAGTCGGAAAGACGACGAAG
GTCGCACGAGCTCCACCACGTCGTCTTCCAAGCAGAACGGCAGCAAGTCGACGCTGGGGAGACAAATCGGCGAGAAGATGCGGTCGTTCCTGGGTGGCGG
CAGCAAGAAGCAGCACAGCAGCAAGAACTCGAGCGGCATCCTCAACGCGTGTCCGGGTACCGTTCAGGGCGAGGAAGGATGGTACGAGCACGGCGAGAAT
GAGCGCTACTACTTCGTGCTCGTAGACGGCAAGTGGAGTCTTCTCTACGGACCCATGACTGAGGACGACTTCGAAGTGTTCTCCAACCGGGTGCGTGGTA
TCGGTATTCTTGTCTTGATATTTTACCTAGCCTTTGGTCTAACATGGGCTTTGGTTGCAGGTGTTGGAGCAAAATCGCGCTATCGAGCTGCCGCCGACAT
ATCTGCACAAGTCCGGCTACTATCTCAACCGCGAGCTGCGTGTGCAGAGGGAGCAGTAACAAGCGTAAGCAACTATCACCATCAGCACCACCATCTTCTA
ACAAATATATCATGAGAACAAAAGTACCAAGTGAAAAGAATATGTATCCATTCATTCATTATAAAGTGCTGGTCTCATCGAGAGCTCAGCAATCATGCAG
GGTTACTTACTTCGTTGGGCCGGTCAACGGTCGCCTAAAGTTTCCAAGACGACCTCCTTGGGGTAGTACAGCTCGGGTGCGATGGTTTCCTCTTGGAAGC
TTGAGCCCGTAAGCCACTGCGTCGGCGAGCGCAGCAGCTCCTTCAGTTCCTCACTCAGGGACAACTTTCTCCGCGGAGAAGGCGGCGCCGCGACCTTGGC
TCCAATTTCCACTTTGAGTTTGTCAGTCTTTTCCTTCGTGGGTGAGCTCGCTGATAGCGCCGCGTTTGCAGCTACGGCATTCTTCACCAGCTTCCACTTC
GTCTGCTTCTCGTGGGGCGACAGCGGCTGCGCAACCCGCTTGGAATGCGACAGCTCCTTCCACGGTCCATCTTCGACTGACTGGTTGGTCAAGCCTTCAT
CCTCGGTCAGGTCCAGATTCAGAATCGACGGCTCCTTGCGCTGCCCAAGCCGGACCTCGTTGAGCTTACGATCCACGAAAGTTGCTTGCAGCTCGGGGGC
GACGCGCTGTGCGACAGCCGCCACCTTTTCTTCGTTGAGCTCCTCTGAGCCGGCTGTGCCTTCTGTGTGGTACTTCATTTTCCCCAGCAATTCGGGCGTG
CGCGAAATGCTGAACGTGCCCTCCCTGTGCATCTTCATGAGCTCCGAGAGATGCTGTTGCTGCGGCAGCCAGTACGTTGCCACTGTGTGGTAAGCCTCGC
GGTGCCGCTCGTTGAGCCCGCTAGGCACCACACACACTTGTTCAAGCTTGTGCAGCAGCACCGGGGTCTCCTCTGAATGCAACTTGCGGTTGTTCATGCA
TCGTTCCGCAAGCGTCACCAGCCGCTCCAGAAGCTCGAGGTTCGTCTGGTACCGTTCCTCCAGCTTCGCTTGAGCCTCGCTTTCGCGCTCTCGCAGTCTT
GAACACTTGTCACGGACCTCCCGTAGCAGCATCTCCGTCCTCACCATGTGCATTTTGTTTGCAGCCTCGAACAGTAGCAGACGATCAAGCAGGATCTTGA
CTCCGACGCCTTCTCCAAAGATGTGGTCGCACCATCCAAGTCCGCACTGCAGCCACCGGTTTCGCAACGTGAAAGCTGCAGATGACCACACAAGTCGTTG
TCGATGAGCAGCGCTTAGCTTCCGCTTGATACTCAGTGCCGACGTGTCAAATCCTAGCAGCCAGTCTGCAATCGACTGGGTAAGTGACGACGTCTTCCGC
TGCTTTGGAATTAAAACACCATCAAGAGAGCTGCAGTCCTCGAACGGGAAGGTGTCCGCCAACCTGTTCTTCGTCGGATCCATTCGCGTTCGAAAGCTGC
TCATCTCCTGGAACACATTACCTGCATAGCTGATAGCTGTGTAGTACGCCATAGCAGTGGCATTCTTGCCCGTTGGACAACGCGCGAGAACTTCGGCGCT
GGGAGAACGAATGCGCCCAGCATTAGCTGCCCTTTGAAGCTCGTCCTCTGTAAAGGCCTCAGGGGGCAGGCGATAGTTCGCGCCCGTTATTTTCTTGTTC
ACATTGTGCAGCTCCATGGCAATCTCTTCCTTCGTGACTATCTCGTCCCGATCCTTTCCGAGAAGGGCTCGCATGCAGCGGTCAAGAGCTGCGTACTCAG
CCAGCCGTCTGGTGTAAGACTCGTGCACGAGCTGCCGCTGGAACCGCTCCACAAGCGTCAAAAAGTCGCCGCTCATGTCAAGTTCAGCAAATTCAACAGC
GGCAGCGAACATGTCGGCATCCGTTCTTTCATCTTCCTCATCAAGAGCGTGCGATCTCCAAGGAAACGTGCGAATCAGTGAGTTTCGCTTGCGGAGGGCT
TCGATGAGCAGCGTCTTACGTAGCAATTCGATTTGCGTGTCGATGATACCCAGTCCCGTGTTGAGTGCCTTGGTGGAAGAAGCTGCCCCTGAAGCCGTCT
GGATACTAGCAGCACCAGTTGCCTGCGTTCCGATACGAACCCCTCGCAATATCACAGGATCACCCTTGCGATCCATTCCTCTCTCCTGGAGCAAAGTCTG
GATGGAAGCCGTATCCTTCGGCAGGATGACTTCTTTGATCTGGTGGCGGTGCATGAGTTGAAGCAGTGTCGTAGGGTTGGCTGTCGTTGGGACAGCAATA
CCCTTTTCGACTAGCACCTCCTTCTGCATCGTGAACGCTAGAGACTTGACCAGATTTTCAACTTCGGTCGTTGAGATCTGTCGAATTGTCATCTCTCGCA
GGAGAAGTTTGTAGTCGTCAGGTACTGCCAGCTCGCGGTTCTTACTCACAACGTGTTCGACGTTCCAAAGCAAATCAGTTTTTCCGAGACTTTCGATTGC
TTCATAGAGCTCGGCCACGCGTTCTGGGTTTGGCAGCACAACCGCTTGTTGATCGTCATCGCGATATTTCTTCAGTAGTGTTTCGAGTTCTGCAATCTCT
TTCGAGACGGTCGTAGGCAGCGCTACCGACTGTGAGCCGGACTTCGGATCGGCCAGAGTCGGGGAGATCCATGCTTCGTATTTAGCCTTGATGCTTGCTA
CCTGGTCGATGTCAGTCGGGTCGAACTCTGAAGTCCTCGGGATTACGCCGCGCTCTTCCAACGCAAAGCGAACATTCTCGGGGCTGAAGACCATTTCTTC
TTGAGTAATAGAGAGACGTGTGTCTTTCCCGTCGCGCGAATAGGCCAACCAGTTTTTCTTCTCTGCTTCCGTTGAAATGCGGTGATACGGAATTCGCTCC
AGCTCAAGTTTGGCCTCCTCGATGGAGTACCATTCGATCATACCTTCTAGCTGTTCATTGTCATCCCCTCCATTCTCAGCTCTGAAGCTGCCCTCAGATG
ATAAGCGACTGCTGGAATTTTGTTGGTACAGGCCACGCATGCTGGCTTCGAGCTTACTTTTTGACAGCGAAGGTGGACTTGTCCCGATCGAACTGGATCG
TTTTTCAGCTTTGATCAACTCATTCTGCCGCTTCATCTGCACAGGAATCCACAAGTGCATTTTCTCCAGGACGAAAGGAGTGTGCTCGCAGTCAATCGTG
TGCTGCAGCTGCATCTGAACAATCTCATCCAGCCATTCTTGCACCTGTTCCCACCGGTTTTGAACACTAGTAAGCGCTCTATCATCCACGTCTGCAAAAC
CCTCGCACTTTTCATCAAGTAGCAGCAGCAGCTCGTGTGTCCGCCGCCAGTGCAATCCCTTCTTCTCCATCAACCGCAGTTCACTCAAAGGACCATTCGG
CTGTGTGATAGCCATCCAACGGGACTGAATATTCGAGACACCCTCCGAGTGGCGAGCATTGAGTCCCTTCAAGCAACGCTTCTCCACAATCTTCAAGAGC
ACCGGCGCGCGAGTCAAGTTTAGCTTGCGCTCTTGCATGCTTACGAGCTCCTCCAAAGCATTCAACAAGACCAGCCACTTTTGCTTCACCTGCTGCCATG
CAGTACTCAGTCCAACGTCTAGCCCTTCGACCTCCTGTTCGATATGATCGAGAATTTCCGGTGTGCGGTGAGCATGGATCTGGTCTGCGGCTTGAATAGT
CAAGAGCTCGTCCAGCTCGGGTTGAAGATTAACCCAGCGTTCGTGTACCTTCATTACCACATCTCGGTAGTCTTTGGCCATCTGCGCGACCTTCTCCGTG
TACTCTAGCTCGTCCTCATTAACACGTTCCTGTTTGCTGTGTGTTGGAGAGCTCTCTTGTAGGACGAAGATATCCCACACAAGGCTAAGTAACACCGGTG
TGCGCTCCCAATGCAACTTCCCCTTGGATTGCACCTTGAGTTCGTCCAAGTACCCTTTCATGGTCATCCAGCGCCGACGCTGAGCTGGCACAACTGCATC
GTGGAGACGCCGGCGTGCCGCTTCGTGCTGCTCGATATACCTTGATTTCCACAGCTTGTATACATTATTCGCTTGCTCAAATAATGAACTCTCCGAAAGT
TTCAAATGAAGACGCAAGTGAACTTTTCCCCGGTCAACTCCTAAAGGGCTCGGAGCAGCGTATGCGGTACCACGCAGGTTTGTAGTCGGCAGATAGAGGA
GTTGGTACATGTCATCGCGTGGATGCTGGTCAAGAAGATCCATCAGCGGGATGCAAGCGGTGCCCAAATACGAGTCGACGTTATTGCGATCTTCATCCAT
CACCTTGACTCTTATCGAGGCTCTCATGATCATTTCGAGTACCTGCGCCAGTTTTGCCAAGCGAATGTGCTGATACAGTCGGTGGCGAACCTGTTGATCG
TCATACTCCAGTTCGTCCACTTCGGTGTCAAAGAATGACAGTAGTCGTTCGCCTTTAGCGATGTCAGCGTGGCCACCCTGGGCATCCAAAACGTACAACT
CGTCCAACTTCGGAACGTATCGTGTCATGAACGCCTCGTGGAGCTTTTGAACAAATTCGCGCACACGAAGGGTGCAGGTACCCACATTTGCCTCCACAAC
TACAATATCATGGCGTGTTTGCTTGCTTTCGTCAGCAACTACGTCAGCCCCCCACGGAAGCCTCCGTTCAGTCATGTAGTCGCCCAGGCCCAAATCATAA
GCCGTTTCTTTGACAAATAACTTCGTTTGCTGTACGGAATGACGCCATTGACTAACAGCACGAGAAGCCAGATCACTGCTGCCAGCTTTTGCCCTTGGCG
CTACAATTGTAGATACGGAGGTAGATGAGAGCATCTTATCAAGAGCGCGCACGAGACGACGAGCCTGAGATAACTTTTGCACTTGGATCTCCATTTCAAG
AGGCTTTTTCAGCACAATTTTCCCACCACCGGAAACGGGAGGTCCAGCTGCAAGGAAACTGCAGGTGAGTTTCTTCTTGCGGTCGTGAAGTGTTGTTTTA
AGCAATTCCGTTGGGCAGATGCTCCAGAAATCCATGCTTGATCTGAGTTGTCGCGCGTACACGTCTACACATTTCTTGTCAACGTTTTTGATTCGGGAAA
TAGTCAGCGAAATCGTCCCCACCACGCGCTTTCGTTCCGATCCCTCTTGGTTCACGCGTAGAATCGGCTCGTCTTGCGGCTTCAGCTTATCACCGACTGT
CTTCATCGGAATCGTGACAGTTCCGACCTTCGCCTTCGTTTTCTTATCGCGGATGACCAGCTTCACTTCAGAAACGCGATCCAAATCAACACCAGGGTAC
TTAAAATCGACCGACGGCGAGTTATCCACCTTCGGCGCTTTGGTGGCTTCCTGTTTGGCTGTTTTGGCGGCTTCCTGTTTGGTTCGTTTGTGCGCTTCCT
CATTTACCACTTTCTGCTTTGTTGCTTTCCAGACTGCAGGCAGCCTCTCCGACTTCGTGTTCAACGCTGAGACGTCCTTCTGTGGCATCAGCAAGAATGT
CGAGTTTTGTGGGTAATCTTTTTTCCCCGGCTCAGGTACGATTTCGCCTGTAGCTGAAAGCTTCACACCGAATGGCGTGAAAATCTTTTTCTCGGACGAC
ATGTGCGTTTGATAGTCACTCGAAATGAGCACCACTTCCACGACGAGACCCTCCGTTCCTACCTTTTCTTTGAGAACCATGTTACTCGCTTCCAGTACTT
CAATTTTGAGCATGTCGTACTTCAAATCTGCTGTTGGCACGTCTACCGCGTCTCCATATTCCCCCTTTTTCTTTCTAAATTTAACGGAACAGCGCGATGC
TAATCCATTGCTCAAATCCACCGTTTCCGAATCAACCTTAGCTTTGATGAAGGGGGTGACTGTTCTACGAACGCCAGCTTCTTCCAAAACATCGAGCATT
CGGAAGTGCAGCTCATGCACACGATTGTCGAAATCACAAACTTGGACTCGGATGTCGTCACAGGGCGCAAGGGATACTTTGGGCACTAAGTCTCGTCTTC
GACTTGCGTTAGTGAACGCAACCGGAACCGACTTCGCAGGCTTGCCTGAAGTCGCCAAGGTCCACGACGCCTTGTCTACAACAACCGATTCTGGCGCCTC
CATGTCTTCATCCAAGACCAAAGTGGTTACATCTTGTAGCCGCTCACAAACAGCAGTAGCGTCTTCGTACGCAGCGGCCACGGCATCACTGATGTCATCT
TGGTTATCGTACGGTATGGTCAGTTGGAACTTGATGTCAACGTACGCATCTGCCATGGATACATCGCTCAATTCTTTGGCAGCTGCACTAATGTCGCTCG
GTGGCATACCACTGGATTTGAAGTCAAACTCCACATTGTGCTTCGGCGCGCTGCTGAACTCCACTTTCACACGTTCAATGACCGCAAAACACTCCTTGGA
AGCAGACTTTGAATAGGCAGCGCATTCCGCACGCAGCAGTCTCTGACAGAGTGGCACGACAGAGCCAGGAGTTTTGTTCAGAGTAGCCAGGATTAAATCC
TTGAAAAGTGCCTCCGACTCGGAAGATGAGCTGACTCTGATAAAGCCGTCAACTTGTACCAGCGGTGAAGGAGCTACAAACAGGCAGAAGCAGTTTTTCT
TATCAAACTTCGGCGAGGCTTTAGAGAATGAGTTATGATTGCGCCGTTTGCATGCTGCAGTGTACACCGTCTCCAGCCGCTCCACCTCATTTTTATCCAA
GCTTTCTCCCTTCACAAATCCATGGTATTGGCCGAGGAAACCCGACTGTTTTTCATTCTTCTCGGTAAGGAATCCCTGGATGAGCGAGTTCGTCGTCGGG
TGGCGTGCTTGAATAGATTTCACTGGCGCAGGAAGGATAGCGTATACGGCTAAGGCTTTTTCGCTGCCCCACCAAAGATCATTCCCCGTATCCATTGGAG
CTAATGGGTTCGTGCAATGCAAACTTGAGCTGAAAGTTGCACCCAAGAATGCTGCGTCTGCCACAAAAACCTCCTCACGAACGCGAAGCTGGCTTCGCAC
CAGACGCTCAACCAACACGCCGTTTTCGAGAAGCACGTCGTACATTTGTGAAGGAGGAGCATCATCCGCTTCACCTCTCGGGTAATAAGTGCTAAGCACT
TTTCCGTCATACAACGAAGCATCGTTCATACAAGTCAGACGTTTTCGTGCCACCGACTTTTCCTCAAGTGGGTGGCGACCATCCATGTACATGACGTCGT
ATCGTGCCTTTCCACAACTCTGCAAAACCTTGGCGAGTCGTCGCTGGGTGTTGGAGCTTGCTTTCCTGTCCTTACTGTCTTCACTGACAAGCACGTAATC
TTCTTTCTGAAATCGCCGCAGTAAAATTGCCCCGTTGACTAGCGCGATCGAAGCATCCATGGGTTCGCTCGCGAGTTTTTCTTCCTTGGGTTCTTCACCG
TCGAGGTATTCAAGTAGCTTCTCGTTCTTTTGCTTGATCCGCGCAAGACGCCCTCGCTTCATCTCTTGGCGATTCCCATCCTTTTCAGGTGCGCAGACAA
ACACGGTATCTTTCGAGATGTCACCGACTAATTTGACATCGTAGCGGTCGTCTCCATACTCCTTGACAATCATCGCAGCTACAATCTCATCATTACTAAG
CCTCACATCCACCAACACGCCAGCACATTTGAGGAGTGGCACCTGAGCAGTTACTCTCTCATCAACGCGTATGGGGCTCATCTTTCCGTGAACGCTATGA
TCCAATCTTAGTGAGCCGTTAATGCCAATTGGTGGGCTGGAGCCAGCATCCTGTAAAGCTGAGAAATCAAATCCAGTCCACTCGCACTCCATGAAAAGCG
CTTCTAGCAGACGCGGGGTCTTCATGCCGTGCAAATTCCCAGTCATATAGTCTTTCGCCTCGTTCACATGAGACAATATGCGCGACCATCGATTGAGCAC
ATCGTCCAAAGCAACTGCATCGGCATACGATAGACGATCCCTCTCTCCAGCCGAAAAGACGATTTCAAACACATAAGCCAAAAGTTGAGGCGTGACTTTC
CAGTGAAGCTTTGTCGCTTGGCTCATGACTCTCACCTGAGTGAGCAACTCCTGCGTAAGAACCTCCTCTGAAACATTGGGACCCAACGAAGCGTTTGCTC
GACATGTATCCCAAAGGAAAGTTAGTGCATCTTTCTCCACATCAGGGTTGTATCGCCCACTGTTAAATGTTCGCGAATCAAACGAGAGTCCGGCCATGCG
GAAAGTATCAGCCAATATTCGTCTGACACGGTCCGCTCGAAGGATTCCAATCAAGTTTAGATCGAAGGTCAAAGTCACCTTCTGCTTGGGGTTCTCTTGG
TCGATTAAAACGATCGTTTCATCGCGAAAACTTGCGCGCTGCAGCGGGTTTCTCAGTGACAACTTTGGCTTTTCCTCCTTGTCGTCCGACTTACGCTCGG
ATTTCTTGTCCAATTTGCCCAGCTGTCCCTCCAATACCCTTCCAGTCGAGTCAGAAACCAAGCGCACGGTGAGATAGTCGACTTTCGCTAAGTCGTACGT
GCGACCAAGAATTTTATACGCTTCTCTCGGTAACGGTGCACTATCATTTCCAGCTCTGGTGGGGGCAGCTCGCTGAAGTAAATCTTTGAGCGTGTACGGA
TTTCCAAACCCAAGGTCTTCGGAGGCTGGGGCGTACTGAATTCGCAGACCGCCTTCGCCGTGGGGCTGGAAATAGCAAGTGTACTCGCCCAAGTCTCCTA
GTGGGTCCGCCTTTTTGATTGCGATCTCGGCCGAGTAGCTTGTTTCCAGCAGTTTGACATTTGGATCCGCGTAGTTTTCGTTACGCATGAGCTCAACCAC
AAACCGCAACTTTCCTAGCAATCCATCGGGCTTAGGCGCTTTCTTCTTTTGCCGCTTTGAAAATTCCGGGGCTGAACAAGGAAGAAGCTTCGCTTCTACG
ACAACTCGGTTACCCTTGTCCAGCTTCAACTCTTCCGTCACATTCTCGCCCATAGTATCAGAGTGCTTCATCGTTACTCCCCTGATGTACCCCGCCTCGC
TTCGTTGGAACTCAAGAATCACACGACCCAACGGGTCATTCGCCGAGGTTGCGTCGTAGTCCATCACGCGCAGCATTATTCCCTTCTTACCACTGAGCTT
AGTCTTTTCAGTCTTGCCCAGCAGGAACTCTTGGTTCTCCCAAGTTGGATTGAGTGTTCTCATCTTGATGTCCGTTTTCAGGCCCGTGTCATGCTCCTTC
GAGTCTTCTTCACCTAACAAGACGATCTCCACGAAAGGGTCGCTTGTAAAGAGGTCTGCTACTTGTAGACTTCGCCCCTCCAAAATCGAAACCTTCACAA
ACGATGGCTCATGTCCTTCTGCAAACGGAGCTTGCTTCTTTTCCTTTTTAGGCTTGTCTGCTGACTGCATTAAGGTTTCACTCCCCACTTCTTCGATGAT
CTTTGCACTGCGTTTTATTTCTCGCTTTTGCACACGTTTGAGCTCCACTCTGATCTGGCCAAGTCCGGTTTTCTGAAGCATGTCGTTGGCAGGCCCAAGC
GGATACCACGCGTCGATGGTGCGGTGAGGCGAAATCATTGTGACAGGAATTTTGAGAATTCCTAGTGGCTTGTGGCGGTAGCGGTGCTTCAGCATTCGAG
AAACACAGTTCTCTAGATCCGTAGCCTTGAACATAATGTTGAGATCTGTGCACTTGTCACTCACTTTTTGAGGGTCCAGGTCTCCTTCATTCATCCGAAC
GTGCTCCCGCATCAGCCCTACTTCGACAATTCGTTCGTTGGCATGGCTGTACTCCACATCGTAAAGTAAAAACATGTCACGCTGGGACATCGGCAAAGTC
ATCCAAGATGCCTGGTCAGACACCTTGTACTTGGCTAAGAGCTTGGTGAGATCATGCGGAACCATCTCTTTGTCCTTCAAGTCATATTTCGTTTTGATCG
GGTAATGTTCTTCCGTGAAGGGAGTGCGAATACGAAGAATACGCGCGGAGTATAGCGAGCCGTTCTTGTAGTTTCCGCTGTACTTTGGCTTGGACTTCAA
CTGCTTGCCTTTACCATAATACGCCATCACCACGTCACCTTCGGCGCCTGCCTTCTTCAGTTCACTTCGCAATTGCGCACGCTGTTCTCGCCTCTCCCTC
TCGTGATCTTCATACGACAACTCTCTGTCGTGGCCAAATAGACGATTCAGCAGGCGATGGAAACTTCCGTCAAGGTCGTTAGGCTTAAATCTTGTGGCAT
GTTTGTTGCACTTCTGCTGCAGAACAACGGGGTTTAGCCGCTTCATGAGTACCCTCTGGCCCGGAAACGCCTCAACACAAACACCTGCTCGTGCAAGCGC
ACGGATCCACTTCTGAGTATTCTGCGTCTTGAACTCAATCACCCTTTCTCCCTTTTCTCGAACTCGCGCCATTTCGTCGAGTGCTTCTGTGGTGGCAGGA
ACGTAGTCTTGCGAATCCGGCTTCCGTTTGTATACAGTGGGGTTTTTAATGTCTAGCCACCCGCCTTTTGCATCGCTTGTGACGTGGTAAGCTACTTTGC
AGGCAGCACTAGCCATGTCAATGAAGGCCATCGGGTATGTGGAGGTTTCTTGTTCGTAAAGATACAATTGCCTACGACCTGGAATGAATAGGCAATACTT
CCAGTTCCACAACAATTTTTCCACAACTTGCGAAGTCTCTTCAGTCTTCTCAGCAGCGTGTTCGTCAGGTTTTTCAGGCACGGAAGGTTTGCGCAAAGTC
CAGCCCTTAACGGAGAACAGTAGATCGGAGATCATCGAGTGCATACCAAGAAACCCGTCACAATGCTCCGTGAGCTTCTTCCGATAAATCTTGCTTTCTT
TGACGATACCAATAGAGTCCTTGGCGGTGTCCTCTTTGAGTGGGTTCGGCATCGGTGGGCAGTAGCAGTCAATCTCCTGAACGAGGTCCAAGGGGAATAA
ACTCTTCTCGCGCGGCAGCTTCTCAATCCACATATCGACTTCATGCAATCGGTAGAAGCGGTCCGCCTTGTTCTCCATTAGAACTTGTCGCTTACCCAAG
TCAGCCAAAGCTACAATTCCTGGAGTGACGTTTTCCACAAAACCTGCAGCGCACAATGCACTCATCCACTGTACTGCTTCGCCTTCCTCGGTCGGTCCGT
GAAGCGCTCCAACACCAGTGACTTCACTTGGATCACCCCAGCCTACAGTGACAGAATCACATGCCGGGTTCTTGGAATACTTTCTCCATTCGTCTGACCA
CAGCACAGTGGGCTCACGCAGAATCCAAGCAATGATTCCTTTGCCCGTGAAGCTTTTTGGGACTGAGAGAATCGAAGTACTCGTTTGATCCGACATAAAG
AAGTCACCATGATCGCGAAGAAGTTGTTGCCGCTTCGAACGTATTTGCATCCACTCCTCCCTAGGTGTACCAGGTTTGGGATCATCAGGTTTGTCTTTCA
CTCCTGCCAAATCCAAAAGCTCATTTTCCAAGCCTACTACAATCTCTCTTCGCACGTCGAGCGATAGCTTCTCCAATGTACGGCCGATATACTCGCTGTT
CGGATCGGCATTCACGGTGTGGATCAGACGACACTTCCGCCTCATCTCGTCAGTCGAAAGCATCTCAAACTGCTCAAACTGGCGGATCTCGCGCAAGACG
GTTACGATGCGCTTCATAATGACCACGAGAATAGTGTGCAATGCGTCAATTTGAGCATTCCCAAGAGGTGTCAACGACGAACGAAGTAGTTGCCTCCGCT
CGATCCACGTCGCTCCCCGAGCGTAGATGGACGACGGCTCACTTTTTTGCTGGTGCTCATACCACGTGCCTAATTCGCGATCCCACATACGGGGCTCCAT
TTCTACTGCATTGGTGGCGGTCTGTGGCGTTGGCTGCGGTTGTGGAGTGTCTGTCCGCGTTGTAATATCAACGATCAGACATCCCAGCGACAAGTAATAG
GGCACGTTGTGCTTCGGAGCACTCGATACGTCAACGGGGATAATTTCCAGGCGCAATTCTTTCTGTCCAAGCTCCAAGCTGGCGAGATCCACTTTCGCAT
ACCCAATAGTGCGCTCCACGAACGTCTTTTCTGCTGTCTTAGGCTTAGCGTCCTTACTTGATTTAGGAGACTTGTTCTTCTTCGACTCATTCGTCGGGAT
CTTTACCTCCAGTTTAGCATCCACACGTATCAGGATGCCTGAGCTCATTTTGAGAACGCGAGATCCCATATCGGCTTGGGTTGAATCAATCTGCTCGTTA
TCCGTATCATCCGCACGGGATTCCTTGCAATCAGCTGACTTGACGCCGAGTAACAAAGGCTTCTTCTGGAACAAGATCAAATCATTCACCTTCGCTGCGC
TCCCGTCTTCACGTTTCGCTTCTTGACCTTCAGTCGACGTACCCTCGTCAGCTGCAGGTGATGCTTTGTCACTTCCTGTTTCGTGCCCTGCAGGCACTGC
CTCTTCGTCTTGAGTTTCGCCTTCCTCATCACCAGGTTCTGTCATACGCTCAGATTGGAATTCAACAGTAGCCTCCAGAGGGCACTTCGTCTCCCACTTC
CGCTGGTTCGATACTGCAATTGGTTTTCTCGCGAGGAGTTCGCCATTGCTATTGAGAGAACAGAGGTCTTGTTCGATCTGGTCTGGGTTACCTAGCAAAG
TCACTCGGCATGAAGGCTCGCTGGTCTCATCGAGTGGTTTGAGACCCACAAGTTTTCCGCTATCGTCGTAGATTGGCATTAGGAGATTTGACACCGATGC
GATGTCGATGACAATACCGGAAAAATCATGCTGCAGTTTCGTCCACCGTTTCGTTTCCTCTTCCTTGATATCAAAGCGCCTGGCCATCACCATCTTCAGT
CCATCCGTTAAGCCTTTTTCCAGCGGGATAAGCTGAGTTGGCATGACAGTATACCGTGAGCTGTCTTTCGAGTTCGCGCTGCCACTCAACTCGTTCTCGA
CGACCACGTCCACTCTACCGTCACCACGTACCGCTTGGACGACGCCTTCTACGTCGAAGGAAAACAGATTCCGGAGCTCAGTAATCGTGTCGATTTTGTC
CTCGAAATGGACTTCGTACTCATCGCGTGGGAACGGAATGTACTTCTGGACACGTGCGGGATAAAAGCGTCCGCCATCCTCGCCACCACGAAAAGCCAAT
ACACGCTGATCATACTGCAAGATCTCAAAACCATCATCGTCGATCTCTCCAGAGGGGGATAATTTGTGTATTTGACAGCGCTTGAGTGTTTTCTTAGGAA
GTTCATCGAGTACTTTCTCTTCATCTGGGAGTAGCTTGGACAGAACCACTTGCTCATCGTTTTGCAAATCTCGTCCATACAAGTGAAGAGAGAGGTACGA
CACCTTGGAGATATCCTTGGTCTTTCCGAAGACGAACTTTTCCTTGGGCCAAAATGGATCGCGGGAATCGTACACAGTGAGGCTCTGTACTCGCTCGGCA
TCTTCCAGCGTTCCATCGCCACGAACAGGAATAACAGTGAAGAAAATATTCGCTGCGTCTCGTGCTCGTCCAAGTTTTTTCTGATACTGTGTCTCCGGTG
AAAGTTCAATATCAGGCTTCAAGAAATCACGGCTTGTAGAACCACTCGCTGCATCGGAGAGCAAAAGATTCCGAGCCTCGTGAATGCGCAACTGGAGCAA
TTGAGTCTCAATACTTGGATACTTCGCATCATTAAATATTCCTGGATACGACAGCGAAAATGAAAACTTCTCCTTACGCCACATAGCGGTGTTGGTATTG
TTCAGCACTTTTGAAGTAGAGGTCCGAATTGGGGCTCCACGCTGAATCGTCTCAGTCGTTTCATCTTCCAGCTCCGATTCATAAAAGTCCGCTGCCGACA
TACTCGTGTTCATTGAAACTTCGCTCTGGATATTTGCCTCGGAGAAGCTGAGAATGCTCAATGACTTTTCCATCGGAATATTAGCCATTCGTTGCATCAG
TTCCGCCAGCACTGTTGCATCTCCAACCATTTCAGTCTTAATGCAAAGTTCACCCAAATGCTTGGCATGCTTTTTCATCCAAGGCTCGGGTTGGAGTTCA
TATCGTTTCACAACTTCTTTCGATGAGATTGACGTGGCGTCCGCGGATGCCCGACAAAGATCGTACAAAGGAATCTCCACACGTCCGAGAGGGGTGCTTC
GCCCAATGTTGTTGTGATCTTTTACGTGAATCAGCAGTGATCTGGCTTCAGAAAGGGGGACGTTCTGCGTGAACATAATGGAGAATATACAGGTTAATGC
TACTGGTTGTAAAAATGTGAAAGCGATATAGCTATGCAACTTACATTGCCAAATATGAAGTTCTCATTTGCCCACACAGGGTTGAGCGTTCTCGATATCA
CCGCTGTGCGCTTCTTTTCAGTTTCAATGTCCTTGCCCGTCGTGCGATCAGTGATAGACAATGTGCAGTATGGATCGCTGTACCCGTTCATATCGGCGGG
GCTAAGTCCATGTCCAGTAAGAATCCCCACTTTCAACATCGGCTTGTCGGGGTTGATGTCGATAAACTTCTCCGATCGCATTTCGTTTTTCACGAGCTTG
GGTCGATGCAAAGACACTTCAGCCTGGGTGCGCTTCGAAAATCTAGCGTTGCGTACTTCCGCTGCAGCTGCTGCCACTCGTTTACTCTTTTGAGGAGATA
GCGGTGCACTTGTACGCTTGACTTCCTCAATGCATACGGAGGGGTCAAGCTCAATAACCGCGTATGGAGTCGGTTTGCTACCAGCATCAGGCTGGTTGTT
TTGGAGTCTGAGATGAGATGCTTGAACGACCGATACTTCGAGTAGCGCTTGCCCTTCCAGGCCAGCTCGCGCTTGAAAGCTTTCATCAGATGATGTTTTT
TCTTGATGCGCACGTGCTATCTGGGTGTTTAAATAGTGAATGCACCCGTTAATTCCATAAAAGCGTGGGTCGCGCGACTGATAATCCGCCGCAGCACACG
GTATGCGAGCTCCATCAAGCTTGCAAGCGGCGTCATGAAGCTGAAACTGAGCATTCTCGTACTCAAGCTGCTCCACAGACTGGTTGTGCGCTTTCATATT
CAACTCTTTGTGAATTTTCAGTCTTCGCACATGTTCCCCGCGCCTCTCCCCAATCAGCCACATTTGTAACTGGATCTCGCCAAGATTCTCGCGAACAGAC
ATGCCTGCTTCTGGTTGAAGAGCGTGCCATTCCGTCCACTTATGAGCCGATAGCTGATCCAAGTCAATCTGCACAAATCCAAGAGGGTCATTCTTGTTGG
CCTTATCGTAGTCGATAATCCGTACTTTGAGGCTTGCTGCCTTCTCAATGTGGCAAATCAAGCCGAAGACGTGGTGCTCGTTAGCCCACGCTGGGTTACG
CGTACGATGCACGACGGCAGTTGTAGCGTACTCTCCTGGAATAGGCTTACCATGATCATCAAGGAGGGTCAGCTCGCAGTACGGGTCCGACGAATTATTG
AGATCGGCGCTAATGAGGTCCTTCGCAGCTAAGACAGTAATCTCCAACCGGTTGTCGGTGTGCTCATTGGCTACAGTAGCAACAGGACTTGTCGTCACAA
CCTCGTCTTCCCGTTGAAAGAAGTCAACAAGGTTGGGCCCAGATATGCTCATCCGAACGTGCAGCTCGCCGCAATCCTTCACAACTTGCTCTTTTTCTCT
GGTGTCGTTGCGTCGGGGGGACGACGAGAATCCGGTCTTCTGCGGGGGCTGCACGCGGAACCAGTCATCGATAGGGTTTGACTGGGCCATGCTTGCTGGT
GACACCTTGAATGTCGAAAACGGCACTATCACCGATCCCAGGCTGTCGTGCCGCTTGAAAGTATCGTGATCCCACAAGTCAAACCGAACAGCCTTCACTG
AATTCAAGTCGACCACCCTGCCGATTTGGAAGTGCTGTCTCCACTCCGGCTCAAGCGTAGCCGTTATCCAATCAGTTCTCTTCTCCTCGATGTCGATAAT
CTGTCCATCTTTGCCCACAAGCTTGATAACACAGTACGGATCGCTCTTCCCGTTAAAGTCGGCAGCCTTGAGATTGCGAGCCTCTTCAACGGTGACGTCG
AGCAAGATCCTGGCCAGCGGGGCTGGTGGAGGCGGCGGCTGAGGAGGCGTTGGTACTGCCGAAGGGAAAGGCTCTGTCTTTGGCATCTCCGGAGCTGGCG
GTTGCTGTTGCGCCACGTCTGGCGTTCGACGGTAGGCGTTGTAGATGGCGCTGAGCCACTCATCCTTCTCCACTTCATTCTCCGCCTGCATGTAGAAACT
CGGCTGCCCGGGCGCAGGCTGAAACACGAAGCACAGCGGGTATCCTTGGTCATTCGTCCGAAGCACATTTGAATCCAGTGTCAGCTCGTAGCGGCGGCGC
GGCGCAGGGTCTTGCGGCGCCTTGTAGTATAGCAGCTCGGTGCGGGTTAAGCGGAAGTACCTCCGCCGCCAGTTGGCCACGACCCTCCCCGACCGACTGC
GCTTCATGAGCCATCCCTCCTTGATGTAGCGCTGATCACTCATCGCGGAGAGACGGCAACAACACGAAGTTCACTTGTCCTCTTTCTTCTTTCGCCTGCG
CAGTCCTCTCCTCTCTCCACTTGCGCAGGCGCTCGCTTCTTGTCTTGTGAGCGAAGGATCGTGATCTTGAAGCGTCGCACGCGTCCCTCCAGCATGTATG
TGGTCCACGCGCAGGATCGATCGGAGCAGTTGCAGAGCTCAGTCCAAATGCATTTAGCATACATATGTACTAGTATTGTGCGCTTATGACTTGGCTCGCC
GGGCTTTCTGGAAGAAAAGCGGCGGTGGGAGCTCTCGCGGGAACAGCAGCTCACCTTTGGCCGCCGCCATCGGTCGGGAGCTTGAATCTCTCCTAGGTCT
CGAGCGAATCCGTCGTGGACTTGTTGCGCCCTTTGCGCTGTTCTTGTAGTAGAGCAGCTGCCCCTCAGCACCAGAGCTCTTGGTCTTCGCCACTACATCA
AGTTGGACCGCACCACTTCTACCGCTTCGCAGGGACATTGAGGCAGGCATCGGTTGCGCCGCGTCTTGGGCGAGCATATCCTCGTCGCACTGGACACCCG
AGTCCTGCGTCTCCACCTTCTCTTCCTCTTGCAGCTTCAACTCTGAGTCTGCAGTCGATGGCCGTTGCTTTTCCTCTTCTTCCTCTGCTCCCACTACAGT
CGGCGGACGCTGCGTCTGCTCCTTTTCCTGTGCCCCCACTCGAGGACTAGACGGTTGCGGCTTGCTCACCTGTACGCCTAGTGCCTGTGTGAGGTGCGGG
GCCAGCGTCTTCCCGAGACACGACAGCGTGACGGCACCCGTCACGCGCCCCACCGCCGCGTTGTAATGGTCTCGGAGCTCCCACGAGCCGCTGAGGCTAG
CCCACTCGCACACGCGGAGCAGCGAGCGGCGGCTCAGTACTTCGTCATCATCGAGCCCCACGTGCAGCTCCAGCGGGACGGCCGCGAAGGCGCGAAGCCG
AGCCCTGCCATGCTCTCGAGCCAGCAGCAACAGCGTCAGTGGCGCCTCAGCGTGTCGCTGCAGCTCGAGCCGCAGCTCGTCCGGGTCCGCTTCGAAGAGA
CAGGACTTGCCATGGCTTAGTCTCGTCAGTGCAGGCTCTGTAGGACAGGAAGCGGCGGCCACTTTGGCGTCAAACACGACGATCTCGTACTGCAACAGCT
GGAAGCCCAGCAGTAGCGCGGCGTTATTGGGCGACTGCGAGGCCGATACGGCGTCCAGCGCCACGCGGTCGACGTAGAATTGAAGCGAGAAGAGCAGAGA
AGAAGAAGATGCTGGCACTGGCGACGCGCTGGGCGCACTCTCAGAGCCGCGGGACGCCACGGAGATCAGCGGCGGCGCCGCGGCAGTGCGGTGTTCCGCA
CTCATGCGCAACTACCAATAACTGATATTGCCTATGACCATCACTCCTAACTAACTACCAGTAGCCGATAAGATACCTTCAGCCAACATGCAGTGCGTCA
GTACCCCACGTTTCAAACTAAGCTCAAGCTCTAGTGGATCGATGGTGCTCCGTCGCCTCTTCACCTCCAGCTCCGCCTCGGCCTCGGCCGCGCCGCGCAT
GGTGCAGCAGCGCGTGCAGACGCAGCTGTCGCTGCTGTCCGAGGCCGCATCGACGCCCAAGACGCGCGTCGTGTTCGTGTCGCGCGCCGCCGCCGCCTCC
TCCGAGCTGCAGAGTGCGCTGCCCTTCCCCGTGTCCGCCGCCGCGCTGAGCGACTTCAAGGCCAAGCCGCAGGAGAAGCTGTACCTGTACCCGAGCGTGG
ACGACGCGGCCTTCAACGACCAGCGCGTGCTGCTCGTGGGGCTCGGAGACGCCGAGAAGGTCACGCCCAACACGCTGAGGGACGCCACGCACGGCGCTCT
GAGCGCGCTCAAGGCCAAGCGCGCCACGGACGTCGTGGTGCAGGTGCCCAACCTTCAGGGCGGCAAGATCGACGCCGCCCGCGTGGTGGAGCTGGTGTCC
CAGGCCTCCATGCTGTCCAACTACCAGTTCGACCAGTACCTGACGGACTCCAAGGACGCCTACGGAGACAGCAAGCTGCGTCTGCCGCTGGAGCAGATTT
ACGTGGACGCGTCGGCCGAGTTCCAGAAGGTGAGAGGGCGGTAGTAAGTTGATGTTTTTGCATTGGAGGAGGTCCTTCTGATGATTGGGTGTTTGTGTTG
ATGCAGAATGTGGCGGAGCAGGCGACGGTCGGCGAGGAGACCATCTTTGCGCGCAACCTCGGTACGCAGGCGGAGTGGCTGCTACTGTGTTCATTTGTAT
GGGGTGACTGAGGGATTCTGTTTCTGTACAGGCAATGAGCGCTCGCACGTTGTGAACCCGGCGTTTATGGAGGAGGTGGCGCGTGCGTCGGCCGACCTCC
CCAACATGTCTGTCCGCGTGCTGCAGCAGGAGGATCTGGAAAAGGAAGGCATGAACATGTTCCTGAGTGTCGGTCAGGCCGCCGTCTGCCCTCCTCGCCT
AGTGATTCTTGAGTACCGTGGTAACCCCGACTCGGACGAGAAGGTTGCGTTGGTGGGCAAGGGCGTCACGTTCGATACTGGCGGCTTGAACCTTAAGCCT
ACGGGTTCGATCGAAGATATGCACACGGACATGTGCGGCTCTGCTGCTGTCCTCGGAGCTGTGCGCGCCGCCTCGCGCCAGAATCTCAAGGTAAACGTTG
TGTGCGCCCTTGCGCTCGCTGAGAACGCTATTGGATCCAAGGCAGTGAAGCCGCTTACGATTGTCAAGTCGCACAAGGGCATCACTGTGGAGAACAACAA
CACCGATGCCGAGGGCCGTCTGGTGCTTGGTGATGCGATGTCGTATGTGCAGAAGGAGTACAAGCCCAAGAAGGTCATCGACGTCGCCACCTTGACTGGC
GCGTGCATGGTAGCTCTGGGCGAGCACTGCGCTGGCTTGTTCTCCAACTCGGACGACTTCGCCAAGAAGCTGCAGGAGGCAGGAACGGATTGCCACGAGC
GCTGCTGGCATCTGCCAATTCTCCCTGAGCACACTGCCGCGCTGAAGGGCACGCAGTCGGACTCGCGCAGCACGGGCCGTGGCCGCTACGGTGGCGCGTC
CACTGCCGCAGCTTTCCTGCAGCAGTTCGTTTACGAGGGCGTGGACTGGGCACACCTGGACATTGCTGGTCCTTCAAACTACAGCGCCGCCAAGTCGTAC
TTCCCCAAGGGGGCCACGGGCTTTGGCGTGCAATTGCTCTACAACTACCTCAAGGAACACGAGCAGCATTAGAGAGTAGACTCACTCACCTGAAAGGGTC
TAACCCTTAGACTTATCGGCGTCATGTTTGTTACTCAATAGAGATGGCAAGTGTGTTAGCTAGAAGGGTAATTACTGCTCGATGTATAGATTCCAGACGA
AAACGCAGCCGTCGTCGCCTACGGAGACGAGCTGTCGATCGTCAGGACTGAAGGCCAGCCCGCGGACATTACCCGAGTGCCCCACGCCGTCCATGATCAA
CTGGTTGGTGTTGAAGTCCCAGAGTTTCACGAGTCGGTCATTCCCACCGGTGGCAAACACCTCCAGGTTGTGCGCCACAGCGATGCACGTAGCTTCTTCG
TCATGAGCCTTCTGAATTACCGTGACTGGAGTGTCAATGCGCAGGTCCCAATACGATATGCGCTTCTCCTGCCCAGCACTGAGAACAAGACGCTGGTCTG
CAGACAGCGCGACGGTGTTGATCCCGCCCATGCGCTGGATGTGGCTCGAAATTCTGCGCTCGTTGCGCAGATCCCAGCAGAGCAAGCTACGGTCGCGACT
GCAGGAAATCACGTGCAGATCGTCGCGATACAGCGCTAGACTGGTGACTGCCATCGAGTGCTCCTTGAGGTGTGAGACCAAGTCGCGCTTTCGGATATCC
CACACACGAACTTCACCGCCGACACCTGCGGACACGATGAAGCGCTGGTTGTGACTCAACACTAGAGATGTGACCCCACCTGTGTGAGCATTATCGATGG
ACCAAGCAGCTTCACCGGAATCGCTGCTGTGAGAGCGAATGCAGCCATCCGTCCAACCGGACAGGAGGATATCCAGCGAGTATTGCAGTGAGGTCGGCGC
CCCAGCGTCCATAACAACGCAGCGAGTCGCAACGCTGTAGTCCGAGGCATCCCATACGCGAATAGTGCAGTCTCGGGAAATGGTAGCGAAGCGATCGGAT
ACCTCAGACGCGTACGTGATCTGCACGACACCGTTCGAGTGGTTTTCAGACAGCAATCTAGCCTGCAGACTCCGTTGCGAGGTACCAAAGGCGAGACGCA
CCGAGAAGATGCCACCAGCCTGGGTGCCAGCGACAACCTCATTCTGAGCTGTGTTTAGCGTCATACCAACGATGCCGCTGTCAAGCGCGACGTGACAAGT
ATCGACGAAGTCGTGACCATAATGAATGACGCTGCCATCGCCGCCGCCAACGAGAATGCCGCCGTCAAAGTACAGAATCGAGTTCACGCCGCAGGAACAG
GCAGGGACGACCTTGAATAGCTGCCGGGTCTTCACACCAACAACGCAGAAGTCGCCACTGGAGCTACCAGCCACGAGAGTCTCCCGATCTGGAGAAAACT
GCACGCAGGTATAGTCGCGAATGAGCGTTTGCTCGATCTTGTGCTGCGTGAGCTCCCCCGTGACTGGATTGAGCACCCAAAGCTGCAGCAATCGATGTCC
AACCGTTGCAAATTGGTAGTTGGCAGTGTCTCGGCGCTTTACATCGCGTGCCATGCCTCCGAATACAACTGCCGTGACGATGTTCGACATCTTTTGGTGC
GTGGCGCAGATATTGCCGGTCAAGACGTCCCAAATGTACAGCCGTGGCCCGTCCTCAGGCACCCCCACTGAGCAGAGCAGTCGCTCATCGTCCGAAAACG
CAAGCGCAGCGATCCCTGCATCGTGCTCCGACAGTCGAAAGGCTAGTCGCCGAGCTGAGTAATCCCAAACAAGGACGTCTGCACGTCTGCCACGCTCCCC
TGAGGCTAGTATTCTACCCGAAGGAGACATGGCGATGCATGATACATTACCCTCATGGCCACGCAGGAAGAGCTGACTGTGTGCGTCTTGGAAGGATGTA
AGCAGGACCGATCCTCCGGCTGGATACACGTAGTCGCGTCCCGACGGGTGATAGTGAATCGCGTTCGGCACGGCGGAGAACCCAATTGTATGCTCCAACT
CGATAGCGGCAGGGGACTGCGACTGCTTGTCAAATCTGTGCTGCGGTTCGTTTGACGCTATAGCGAATCCTCTTGAACTGGGCTTGCCATCCATCGCAGG
AACACCTTCATAGCCCCGGGCGTTGTTGCCGCCATCGTACTGCATCGTCGAGCGAGCGACCCCTTGGTACAACCAGCACTGCGAAAAGACCCCAACACCG
ACCAAAGCGAGGAAGCGTAACCACTACACTATACATATATATCGAACTTAGCTCGCCTACTCGGTGGACTCCAGGAGCCCCGTGGCACCTACATAACTCA
AGCACGTATAGTACGGAGGTAAATTGTTCTCCTGCATCCACCGGGCGACATCCAGACCGATGTCCTCTTGTCTGTCGAACAGGTTCAGCCGCAGGATTCC
TCGGGACAGGAAGACCCGCGACGGTAGCGTGAACGTTTGCATCTACTCAAACCGCCAATAAAGTGTTAGTTAGAACTCCTTACCCCTAGCATGCCACTCA
GTCATTGTCGAGAGATCTCACCTGCATATCCTTCACAATACTGAACACCATGGACTCGTAGACCAGCGTGCCGACCTCTCCATCTTCCCGCAGCTCATAC
AGAGCAAAGGACACCCTCTTCGGGGAGTACGTGGGGCTGCCCGGGTACCAGAACACTCGGTACGGCACAATCTGCACACTGTTTACCATGCAGTTCTCCC
ACAGCGCGTAGTCCAGGTGGTCCGTCGTCGAATACCCCCACGTCGAGGCACTGACTCACACAAAGAAATCCACAGTGAGCAAGTCAAAACGTTTTCCGTA
CAATAAAATCCCGCCGCACCTGCTCCAGTAGCACGGTCGGCCCCTCGCACAGCCGCACTCCTGCTGCAGCCGCTTGGCGATGGCTTCAAATGCCATGGGG
TCGTCCGCCACCACCGTGTTGGCCAGCAGCGCCACCCCAATGCCGCAGTGCGAGCGCGTCAGCGTGTTCTCCGCCGACTCGTTCGAGTGGTCCACCGACG
AGCACTCTACGAGCACCCAACAGCACATAATTGCACTCCGTTAGCTGCACTCAGAGCGTTAATTCCACGCCAAAACAGTCCGCCAAGCGGTCGCACCGCG
CACTCGACGCAGCAGCGAGAGCTCTTCGCCCACGGGTATCTCAGTCATCAGCGCGAGGTGCTTCCACTGCACAGAGCTCCTGGACGCGCAGTCATTTGCA
TACAGCGCCAAGCGCTGCGCCAGGATCCGCCACGTGTCTGCAACGAGCAGCAACAGGTTGAACGGGGTCGGTCAGAAGGCACAGAGGATTGCGACGTAGC
CTTAGACGCAGGAGACGGGGGCGCGCACCACACTGGACGATGACCTCCCGCAGGTGGCGGTTGACGGCCTCCAGGCGCTGCAGCGCCGCGTGGTCCGCGA
ACTGCAGCGTCGCCGCCAGCAGGTCGCTCGGCAAGTCGCACAGCCCCATGATCACAATCGTCTAGTGACCCCGGTGTAGCTTCTGGGCGACAAAGTTGAA
CCTTCTTTGACTTAAATCAGGGCATTGCACTCACTGACGTGGCAGTACGTTGCCGTCAGACGGTCTCAATGTGCACAAACCTATCGATACCATTTGTGTC
AGCCTCTCCTTACATGTACAACACTAGTCGACTGAAGTCTCGAAAAAGAGGCTGGAACGTCTGTCTCCACGCCATTGCGCTCTAGTCGTCCCATCGGGTC
AAGGCTTGGCGCAGCATGCGCTGGAACTGCGAGGTGGCAGCGCGCTCCTTCTCGATCTCGACTCGCAGACGCTTCATCTCGCCCACGGCGCGGTACTTCT
GCAGCGACTCATCCACCGTGCTGAGGCTCCCGAACGTGCGCCTTACGCTCTGCATGGACACTTGCACGGGCTGCTTCACGATGGCACGGTCACGCTTGCC
GCTGCTGCTGTGGTCGGTGGTCAGGAGCTGTCTCGGCGCGGCGGCGTGCACAGCGTCCAGGAGTCTCGCGACACTGGAGCAGAAGCCACGCCAGCCGGCG
GGGTAGTAGATGTTGATGTCGCTCAGCGTCTCGAAGAAGGTCTCGTAGATCTCCTCGAAGATTTTCCGCCACGGCAGCAATGCGTCTGCCTCCTGCGGGG
TCACCGGCTCCGTCGAGTCGTCCTGCGTCAGGCGCTCGTGAATCGGCAGTAGCGCGCTGTAAATCCGCTTCTTGAGCTCGTACGTCGACACCGCCGTGGG
CGCTGGATACGACAGAAAGAGTCGGTCAATGAAGTCCTCCACCTTTTTGAAGTAGACGTCGCAGGTTTGGTCACGCTGCACCGCGGAGGTCTCCACTGCA
ATGCGAGTGACTTCAAGAGCCGTCAGCACCGTGTGAATCTCGTGTCTCCTCTCCTGTGAATTCCAGCCCCGCGGAGGATCCATGACGGCGAAATACAGCT
CGGGTGGCGGGTACGTGAGATCCATCACACCAGACGACAAAACGTCTTCACGTACGCGAGGGAATACGGCGCAGATCTTGGCCTGGATACCCATCGAAGA
CTCGTACTGGTTCATCATAGCCTTGACACTGCCCTCCAGCAGCTCCTTCAGACCGACGCTCTTGAGATTTCGTACGGGAGGAGTCAAGGCCGCAATCATC
ATCAGTGCTTGCCCAAACTTCTGAGGGAGGAGCTTGCCTGCATCAACAAACTCGACGCTGACGCTGGCCACCTGTGAAGAGAATCGGCTTAGAACTCGCT
CAACACAGCTCCCAAGCGTACTCATAAGAAGCGCCCGCGATGACTTGACCTCTGCAGAAGCGAATCCCAGCGCAAGCACACTCACGCGGCACCCCGCCTT
CAATGATGATAGCAGTTCGCCCACTCGCTGCTCCCAGCTGCTGCAATTGCCAGCTTTCTGGAGCGCGCTCAGATCAACAGGAAAAAGAATGGCGGACGTC
GCAGCAAGCTTTTCCGCCTGCATTTCGTGGGCATTTCTGTGGGTAAACGTCGAATCAAGATACCGACAGCACACAGCGACACCCTCCGCCGATCCGTTGC
TCGACTGGAAAGTGCGATAACAATCAGTCTCAGGTTTTGCAGCATTTTGCGTTCCAGCCCTGACGGCGCACCACAAACCAAACGAAGACGATGTCCCATC
CAAGAGGTCTGCTACCACCAACTTCCACGCGATAGACGGAGCACCCGGGTTCTGCCGTCGAAGAGAAGCACCGACCAGTTCCAGGATGTCGTCACAGCTC
CACAGCGACAATATTTCTGCATCTGAACACGGCACATCGGCTTCAGCGGTCGACACTTGCTTCAGTCGCTTCGTGCCAATCGGGGTGCCCATCGTGCCGT
CAGCTCCTCTGAACAACCACTGCACACTGTCTTTCGCCTTTTGATGAGGGCGATCAAGTCGAAGTTTCGAAGCATCGATTGCAATGGGGCCGGGACCGTT
GCGTGAAACCTGCACATACTTCTTCCACATGTGCAGCTTTAGCTTCAAGACGGCGTGCCTCCGCTTTTCGGCGCGGCGTACGAGCTTTCTTTCCTCTCGC
TCCTTGGTTAATTGTGCTTGGCGTTGGGCTTCAAGTGCAGCTTCTCGTGCTTGCCGCGCTCGGGCCTCCGCCAGCTCCTGCTGGCGACGTCGCTCTTGCT
CTTCTGCAGCTTTTCGCCGAAGTTCCTCCTGCCTTTTCTCCTCTTGTCGTCGCCGTTCTTCTTCAGCTGCCTTTACTCGCAGAGCCTCGGCTTGCTGCAG
CGCTGCAAGTCTTTGACGTTTTGCTTCGCGAGCGGCTTCTTCAGCTTTTCTGCGCTGCTCTTCCAGTTCACGCTGTTTCTTTTGTTCACGCAGCTTGGCT
TCAAGCTCTTCTTGCTGTCGCTTTGCTTCAGCAGCTTCCTTTTCGGCTTGGGCTTGGGCAATAGCTTCCTTCTTGGCCTTATCTTCACGTTGAGCAGCTT
GCTCAGCCGCAGCCTTTTTCGCCTCATCTTGACGAGCCTTGTCTGCTTTCGCCTGCTCGAGTTCCCGCATCCGCTGGATCATTGCTTGCTTCTGTTGCTC
AAGCTCCATTTTTCTCTGTGCAATCATGTCGAGGTCGTGCCTTTTCTGGTTGAGATCAGTCGGCTGTTGAACGTTGCCGAAGGAGGTGTTTCCAGATGAG
GACGGGGCACTTGACGGTGGTGCCATTGATGCTCCTTCGTTGTAGTCAACGAAGTAAGAGTAGTCATCCTCATACTTAGGCCTATCCGGGTACAGCCTCG
CTTGCTCTTCGCGCTCGGAATCTTGGATCAACTTGCTCAACGCTGGGTATCCATCTCGCGCATACTCCGTCACGCCACGGCAGATGTCTCGGCGTAAGTA
GTTGCTGCAAACACAAAGAGGGCATTATTGAGTGAAAACACAGGAGCGTTGGCTTGCGCCCACCAAATGATCCGTACCCCTGCTTCATTCCAACGTAGAT
CTTGGAGCTTCGAATCTTCAGCGGCGTATTGTTCCGGCGTAGTTGAACATCTATGCGAAGACCAACACACGACTGTTACTAAAAGCATCACCAAATAAAC
CCCGATATGAGCGCAAAATCGTACCTGTCTCAAAATCCCCACCAAACTTCACAACAATTGAGCTATCGTCACCAGCTCCAGGCCTGCCAGATATCCTTAG
CTGGTGTTCCTGGCACACCGAGTACGCGTGCTCAATGTCATCGAAGCATAGCAATTCCACCAAGTCTTCCAGCGGGTAAGTCTGGCTGCGATAAGCCCGG
TTCATACGAAGCAACGCGGAGGACCGGACATTCGGGATGTACCGGAACAGCAAGCAAGACTGCAAATAGGTTGCTTGTCGGAGCAACGAGAAGAACTGGA
AGTAGTCGCCAGTGTGGCGAGCAACGAATACACGCATCGCGAACTTCATGTGGGGGCTCTCCAAGATGTCACGCGGGAGATTCTTCACGTACTTCAATAC
ATCCATACCCCGACCATTGTCCAGAGTACAGAGGATGAAATACGCTCGGCACTCGGCCTCGAACGGACTGAGGTAGGCGGGATCTCCTACCTTGTGGCTT
TCATCGTACAACTCGTTGAGTGACTTGAGGGTTTGGCCGAGTTGCTCCATGTTTTGCTGCGCCACGAAACTCTGAATCTCGATGAGTTCATGTTCACTGA
GAACGTGATAGCGCGCAATACGCTCGTGAATATCGAGAGCTATCGGGTGCACACGACCTCCAGCGCCACGGTAATTCTGGAGAACAAAATCTTTGCGAAT
CATTCGAAACCGATCCCAGCAGAAGTTGTAAAGCTCAATGGGCTCCGGAACTCGAGGCGGCTGGAAACGTGGATCCAAGCCACACTGCTCCAAATCCATG
ATTGCCTGCTCGATATACAGCTGAGTTCGTCGTAGAACGCCAGGGGGTCGAATCTCCTCGGGGATATCCAATTTATGATCAGCTGAACTGCGCTGGAATC
GCTTGATGATCATGTCTCGCTCTGTTCCTGGCTGGTCAGGGAAACACTTCTCAAACACGCTCAACTCGTCCACCCGGATGTGCAGCTCGCGTTCTGTTGG
GCTACACATATCAGCGCAGAGTCCATCCAGGTTAGTGGCGGCTGCCAGCTCCGCCTTGCTGCTGTCATCGCGGGACGAAGCGACCGTTGACGGCATGGAA
GCGAACCGAGTTTCTTCATCACTTGTAACTGGAGCTCTTTTCTTCGTTCGAGCTTGTCGTTGCTTCGCATGCTTTTCGTTTGTTGGGCTAACCTTGGGTG
CGCCAAATGCGGTTCCTTCTGGCGGGAATTTCTGACTGCTTTTCGGCTGTTGCCCACCAAAAGGATTCGCGTCTTGCTCCGCTGCGGCGCCAAATCCCTG
CGCTCGTTTGCCTTTTCCAAATGGAGACTTCTTCGTGCCGTTCATCCGCGCCTCCATTGATGCCATATTGTCAGCATTGGCGAACCCTCCCGCTGCAGGA
TCGGAGCTGAACTTCGGGGTCGTCTGTCGTCGCTTGTCAGCGGCACCACCAAACGTAGTCGCAGGTGCGGAACCTCCAGGAGGCGATGGCTTCCCGAACG
CTGGAGAAGTTTGGAAGCCGCTAGAAGTCGATGCTCCGCCGAAAGTTGTGTGGACGGTGGGGGCGTTTGAGGTGCCGCCACCAGCAGCAAAAGGGTTCTC
CGCACGTGAGCCCGCCGCATTCGGAGTTATCTGTTTCTTCCGTACTCGAACGCCCGACGCTTGACTTCCAAACGCTGTGCCAGGCGAGGACAGCGGCGTG
GGTGCTGCTGCACTGCCCGATCCAAATCCATTCGAGTCCTGCGAAAAAGAGCCCTGCCCGCCACGCTTGGGCGTAGGCGCACTGCCAAAAGTAGTCTGTC
CTCCACCAAATCCACTGTCGTTGCCTCCAAACGCTGCGTTGCTTCCACCGAAAGACGACGATCCGCTGCCGCCGAACGAAGGCTTCGTTCCAGCATTCCC
TCCAAACGCGTTACCTCGGTTCTTGGGATTTCCACCTACCGACGACGCAGATCCAAACGTCGTGTGTGCACCCGCTGAGTTCGCAGAGGGCGAAGCGCTG
TTCTGTCCAAATGAGTTGGCGCCTCCAAACGCAGTCGTTGCGCTGCTCTGCGTTATATTCTTGTTGGTCTTCTTCTGTCCAAAGGGGTTCCCACTCGAAG
AAGCTCCACCAAAGCCACCCGACGGCGCCGGAGGAGCCCCAGCCAGACCTCCAGGCGGGAGAGGGGGCTGCTTACCGAAGCCACCGCTGCCTGGAGCGCC
AGTCAAGCCGCCCGGAGGCAGCGGAGGCTGGCTGCCGAAGCCGGAGCTCTGTCCGAACGCCGTCTTGGCGGCTGAAGCGTTGCCGCCCGCCGACTGGAAC
GGGTTCACTGCCGTCGTCGATCCTGGACACGCCACGGGGCAGCCACCGATCAATACCTAGAGACGCGAAGTCACAGCCGCCACCGGAGAGAGCCAGCCTC
CTGTCTGTCCGTCCACAGCACGAGCGCGCCCTCCCTCCCTCTCTCGCGCACAGCAGCAGCGTAAACGCAACCCTGTACCCTGCCTCTTACCTTGGTTCTG
CGCGAACGGGTTGCCGCCCTGGGGCGCCCCGAAGCCTCCGAAGCCGCCGCCTCGATCTGCGCAACAGTAGGGAGAACGGATCAGCGCGTAACTCGGCAAC
CAGGCGGCCAATCGGCGCGCATGAAGACGCAACACAGAGCCAAGAGAGTGGAGAACGCACTGCCTGAGCTGAACATCGCGCCGTCGCCCGGAGATCCGCT
GTACACGCCGCCGAAGGTGTCGCGTCCTGATCCGGCCCAGCGCCGTTGGGAAGCTCTGAGGCTTTAACCGTACCCCCTCCAATAAAGTGGTACAGTGTAC
CTGTTGAAGCCAGCTGTGTGGGCCACCTTATTTTAGAATTCCAGGGCGCCTAACCCAGGCATCTGGCTGCGATCTGATTGGCTGCTGCCGCGGGGCATAG
TGAGTCCAAGTGAGCCCGAGGACTGGAGAGCCTTGCGCGTTGGGGAACCACCAATTCTCCCGGCCGCTGGCTCCGCTGGCTGTTGGTGCGCTCCAAGTTC
CAAATTGCCCGCAACTTTCTGAGTAACTTCGCGCGAAGGTAAAATCCCTCGGCGCGTGTGTTCCCCCCCCCCTCATGAAGCGGACACTCACGCGTCTGCC
CTCTGCCTGCCTGCCTGCCTCTGTGTGCTCTTCCTCCCTCCCTAGTTGAAAGATGGTGAAGCACAACAACGTCATCCCCAACGGCCACTTCCACAAGTAC
TGGGAGTCCCGAATCAAGACTTGGTTCGACCAGGTAAGCCCATGAACTGGCAGTCAATACAGCTGCAATACAGCCAGCCAGCCAGCAGCGATAAAGCACA
CAGCCCGCGGTCTCTACTACGGGAACAGTGCGGGATTAAGGCGGCGAACAGGTCTTTCGACGATGAAATAGGGACGCGGGACAGTCTAGATAGTTTAGCG
CGATGGACATTGAGACCCGCTTCAGGACCGTGTGCTCGGCTAGTAGCCTACTGGCTGGCTGACTGCAAGAACGACGACATGGAGTAGAGGTGTACTGATG
CGCGTTATCTTGACGACCCCGAACAGGCTTCCAAGAAGAAGACCCGTCGCCTGAGACGTAAGGCTAAGGCCGCTGCCATCGCCCCGCGTCCGGCCGCTGG
TCTGCTGCGCCCCGCCGTGCACTGCCCCACGATCAAGTACGGCTCGAAGGTCCGTGCCGGCAAGGGCTTCACGCTCGAGGAGCTGAAGGAGGCTGGCATC
AACCGCAAGCAGGCTCTGAGCATCGGCATCGCCGTGGACTTCCGCCGCACCAACAAGTCGGTGGAGTCGCTCCAGGCCAACGTGCACCGCCTCAAGGCCT
ACAAGGCCAAGCTCGTGGTGTTCCCGCGCAAGAGCAACAAGCCCAAGAACGGCGACTCGGCCGCCGAGGAGACCAAGAACGCCGTGCAGCACACGGGCCC
GATCCTCCCGATCACGCGCTCGAGCGTCAAGTCGACCACGGCCGTCATCACGCCCGAGATGAAGGAGAAGAGCGTGTTCACGCAGCTGCGTGTGGCTCGC
GCCGACAAGCGCATCTTCGGCAAGCAGGCCAAGCGTCTGGCTGACAAGAAGGAGAAGAAGTAAGTGTCGTTCGCGTCGACATTTACTGGCCAGCTCTCTT
GATCGACCTGTCTCGTTGTTGAGAGGGACGGCGCTCCCGAAAGTCTTTTGCGGAAAATTGGAACACAATACATCGCGCATCAAAAAAACTGCTTTGGCTC
GGTGTCGTACGCGTTCTTGAGTGTTGATTTGTTAAGTGTTCGATGATGCTAGTGCAACGTGTTGCATTCACGAAAACGCAGGTGCAACAAGCTGACAGGC
TCCTGCCCTGGCAACATCTTGTTATGTAAGTCACGTAACATGTTCACTTCAAGCCGCACTCTGGTGCAAACAACCATCTAAATCTATCTGGCGCAGGGAC
AGCAGTTCAAACCCTGACGTCGGCATACGCTTCCGGTTCGGAGAGCAGCGGCTGCTTCTCTGGTTCGTCCGACAGCATTGAAATCGACTTGAGTTTGACC
CGGCCTCCACCGACCTTGGTGTTTTCTGAAGTGTCCACCTTCTCTGGCAATACGCGAAGGAACGCCAGGACAAGCAGCTGACTGACAGCCGCGATCACCA
CGAGCAGCCAAAGATGGCTCCAGTCCACAACCTTCGTGGTCGGATCCGGAACGATGCCCAGCGCCGACACCAAGATAGAAGAGAGGACTCCAGACACGAC
GCCGCCGAAATCCATGAACGACAGGAACAGCGCGTACGTGAGCCCTTGAACTTCGGGGTCCGCCGGGCAGTAGTACGTAGCGACAACCAGAAGTTGAAGC
AGTGCGAACTCGGAGGTGAAGGACGTGATGAACGACTCGGTCGTGCTGAACGTGCACACGGACACAGGAAGGTCAGCCACCGGTGGAGCCAGCAGCAGTC
GCGGCAGACCCGCAACAACAGAGCTCACTGTCGACAGCAAGAAGACGCTGCGGACGTTCTTGTTGGTGCACCACTTGGCGTACGCCAAGCACGAGAGGAA
CCGCCCGACCATGCCAGCGAGGGACATGTACTGCAAGCACTCGCGCTGGTCTTTAAGCAGCGAGAACGAGTACTGATACCAGACCGTTCCGTCGTCCGGT
AGTGCATTGCACAGGAAGAAGAAGAGCATGGGCGGGAGGACCGGCTTGATAAGCTCCACCTTGCGGTGCAGGTCGCGCTTGAACGGCTGCCACCAGGACG
TCACCACACTGCCGCACGTAGTAGACGTCTGCACTGTGTCGTCCACCGCAGGACTGTCCGCTTCACTTTCAGTCCTGAAATCAGTATCGTACACCGGCGT
CTCGTGCAGCCCCAGCAGACAGACCCCAGCGGCTGTGAGAGGCAGCAAACTGGTCCATCCGATGATCTCCTGGGGCGTGATGTTCTTGTCTCGGTACACT
GGGATGCTGAGCGTGAGCGCCGCAATGGACGCAGCGTTCTTGACACCATTGGCCAGCGACTGCACGTGGGCGCTGCTCCTGCTGGTGGCGTCGCCCGCGG
TGAGATTCACGAGGAAGATGCCGAGCATGAGCTGCGCGAAGGCCTCGGCCACGGCGTCCACCACCTTGACGACGAAGGCGCCGGCGATGGAGTGCACGTA
GACGGCGGTGAGCACCAGCGACGAGGCTGCGACCACCTCGCACAGCAAGATGTAGGACTTGCGGCGGTACCCGAAGAGCGGCACGCTGTCGGACAGCAGC
CCGTAGAGCGGCTTGAGGTTCCACGGGAAGAAAGAGACCGCATAGTAGAGCGACGTGGTGGCCGGCGGCATATGGATGACGTCGAAGAGCCACTCCCCGT
ACGCGGTGCCAGGGAGCGTCATGTAGACCGCGTGCAGGAAGTAGAGCGCTAGCAGCGCCACCGGCACCTTCATGGCTACAGCTCTCTCTCTCTCTCTCTC
TTCCTCTCTGTGCGGCCGCATCTGATACATGACCTCTTCAACAGGACACATTAATAATGATTGATAAAGTGTTCTGAACGGTGTTTCCTCCGCTTTGATT
GGCGAGGGGCTGTACGCTGTGTTGATTCGCTAAAACTCAAAGATCGCTTATTGACCAATGGACTACGTTATTGCGCCGTCACCAAGCGTTGCAGACACTT
GACTATCGCCTGGCGGAGGACGCTCGAGCTCGACGACCATGGCGCGCGACGAGTTCAACATCGACGAGGCCGAGGACTTCGACGACGGCACGCGCGCCGT
GCTGCACACGGAGGGTTCGGACTCGGATGGCGGCAACGAGGCGCAGGACGCGACGCGGCTGCGCTCGTCGCGCAAGCAGCGGCTGCAGGCGGAGCGCCAG
GGCGGCAAGCAGCGCGAGCAGGCGTCGGCTCTGCGCGTCAAGAACTGGGACGCCGGGCTCATGGAGAGCGCCGAGTACGCGGGCAAAGTGGTGACGCGCA
AGGACCTGCAGGAGGACGAGGCCATGGACTCGCCCGACGAGGACGCGATGGCCGACTGGTCGGACGCGGAGCCCTTCGGAGCCTCGGACGAGGAGGACAA
GGCTGAGGAGGAGGAGGAGAGTGAGGAGGAGGACAGCGACGATGAGGACAAGAGCGCCGAGATGCTGATCCGCGGCTTCCAGAAGGAGGACTCGGCGCGG
CTCATGGGCGCGCAGGACAGCAAGAAGGTCGTGGAGAAGGCCAAGCACGTGCGTCACCAGAAGCTGCTCTGGGAGCGCTGTCTCGAGGTGCAGATCTACA
CGAAGAGGCTGCTGACGTCGGCCAAGGATGCTGCGGCGCACGAGACGGACGGAGAGACGACAGACGAGGAGGCTGCGACCAAGACCAAACAGCAGGTGGT
CCAGGAGCTCTACAAGAGCATTGAAGCCGTGTCGGCGCTGCAGGAGAAGCTCTGTAACGTCCCGGAGCTAACGGCTCCGTCCGCGGACTCCCCCACGAAG
AAGCGCAAGCGCGCGTGCGACGAGCTGTGGCAGAAGATCACGGCCAGCAGCCGCACGATGCTGCCGCAGTACAACGACATTCTCAACACATACACGCGCA
AGACCGACCTGGCGGCGGGTGGCAAGAACAGCCAGGCGAAGAAGTTCAAGGCGGTGAACCAGGATATCCTGGCTCAGGTCGAGTCCGTGCTGGTGGACCC
GCAGCGAGTCAAGAGGAAAGCACACGCGCCGCTGGATGTACCCGAGTCCGAAGCCACTGAAGGTTCCGAAGACTTGCTGGACGAGCTCATGTACGACGAC
TCGGACTTCTACCAGCAGCTGCTGAAGGAGTTTATCGAGAGCGGCGGAGGTGGCGCTGGCCAGGACGCCATGGTGAGGCGCACGCACCGCAAGAAGAAGA
AAATCGTCAACCGCAAGGCCAGCAAGGGCCGTCAGCTGCGCTACACGGTGCACCCCAAGCTGGAGAACTTCATGTTCCCGGAGCCGTACCCCAAGCCGGA
GATGGACGTGGACGAGCTGTTTCGCTCGCTCTTCGGACAGGTTCGGCAGTAACTCGGCAGCTACGCTGTTGGCGATGAATAGATTGATTTTGGATCGTAA
AGTGTTCTACTCTACTGCAAAGGCTGTAACGCGCAAAATTCTCTCCCTTCCGCCGATGGCGTTGCGTTGTGTTTAACGGAAGAATATCCTTCGTTTTCCT
TATAGCACATCGTCCTCTTCTTCCTCCTCCTTCTCCCCTGTTAGATACACTTCCTTGATCTTCGCCAAGCTTGCTTCAATTTCCCGCAGCCGCAGTTCGT
TGACTCCGTTAGCGCCGATCTTCTTCACGATGCCCACCAGCGTGATCGCTTTCTCGGCGACGTGCACCACGGCCAAAGCTCGGATTTTCTTGGCACGAGT
TGCATTCTCCAATGACCGGAACTCCTCTTCTGCCAGGTCCATGGAGGCATCAGCCAGCGCCGTCGCCGAGTCGATCAGCGCAGTGCCACGCTCCTCGAAG
CGCTCGGGGATGTTGAATTCGTGTAGCTGTCGCACTTCTGCCGCATACGAGCCGCTCTTAAATACTTTGTGTTTGAGCTTCACGGTGTCCTTCAGCAACT
GCGTGAACTTGTCGATCAGCTCCGGTTTGCCCTTGGCAATCGCGCGCATGGTTGCGGGTGCGTTGAGAATTTGCGCGCGTTTTGCGATCAGTTGGCCAGC
ATCGCGTTCTAAGAACGAAAGCGCCCAGAGCCGCCCATAGGCCTTGCCGGCATCCAACCTTTCCTGGTCCGAGAAGTACCAATCGCGAGTGTCCTTGTTC
TTGATGAGAAGACGTGACGACCAGGTCTGGACGGAGTCGGTTCCCAGCGCAAGTCCATACTCTTCCAGCTTCGGGCCAATTGTTTTGTAGAATGAGACTG
CCTCTTCATCGGTGGAAAGCTTCGTTGACAGTAGCTCCGCCACCAATCGGTTGACCTCTTCACGGTTCTCAACCAGTTTCTTGTTGCTCTCCTTCCGCGC
TTTCTTCTCAAGCTGCTCGATCATGCTCATACCACCAGGACCCTTGAACTGCTGAGACTCGTCACCGAAGATATCATCGATAGCGCTCTCCGCAGCAGCG
AGCTCTTGGGCCATTTGGTCTTCAACTGACCGCGGTGGCATGCCATCTACGACACCACCACTGCTGCCGCGACCACGAGCACTGCTAGCTAAACCTCCAC
CGTTCGACACTGCATTCAACGAATACAGATACCAAGTGCGTCAGCTTTAGGTTTGAGTACAGTATGACAGCCATCTCATTCTACAGTACCTTGTTGAATA
ATTTGCTGGTGCTGCATGAGGATACTGAAAAGCTGCTCCATGGAGACAGGTCCCGTGGGGGAGGCTGGAGCTTGAGCAGGCGGCTGGTTCATACATAAAA
TACAACATGAAACTTAGTAACCTTGCACATTCGTACGAGCACGATAGTACGTTTAGCACTTACACCAGGGTCGTTAGGGGATACATCATCCGGGCGGTCG
AGCAGATCAGGGTCCACTTCTTCTGCCTTCATCTTTAGCTTGATCTGCTCATCAGGCATGCCCATTTGCCGAAGTTTGAAATACTTGAGGAATTTCGCAT
CATCTTTTACAAGCAGTGGTTTGTAGGGAACGACGGGGGCGGACGCTGGCATTGAAGGCCAGCTAAATCCCCCGTTTGCTCCTTGAAGCGGAGACAGCGG
CGACGAAGGATACCCGGTCGAGATTTGCAACGGCGGCTAGAGGCAAAAAGTTAAAAGGTCAGCTAACACAACCAACCAACCAACCATTCGAAGTGAACAC
TCTACGTACGCCAGGGTCATTCGGTGATACTTTGCTCGGCGTGTCCAGCAGAGTGGGGTCCACTCCGTCGGCCTCCATTTTCATCTTGATCTGGTCGACG
GACATGTCCATGCTCTTTAGCTTGAAGTATTTCTTGAACGCGGGGTCTTCGGCCACAGTCAGCGGGATGTACGCGCCCTTCTCCGGCTAAACACCAACAA
AAACATTAGTCCCAACGACTTACAGCCAATATCAAGGGCCATTCATCACGTACACCTCGGTCGTTCGGAGAGACTTCATCGGGCGTGTCCAGCAGTGACG
GACTGACGCCATCTGCCTGCATCTTGGCCTTGATGTGGTCGAGGGGCATATCCAGGTTCTTCAACTTGAAGTACTTCTTGAACTCCGGGTCGTCCTTCAC
CAGCAGTGGCATGTAGACGCTTCTGGCCATCGGCATCATGGGCCCCACCTGCGGCTGAGCGTAGGCCACCGTCTGCGTCTTCTTCTCCAGTTCCATGAGC
TTCTGCTGCAGGGCTTTGATCTCCTTCAGACTGGCGCCCGAGGCGCCTCTCTCTCGGGTCGCAGCGCCTCCTCCGTTCTTTTTGTCCGCCATGAGCTGCG
AGATCTGGCGCTGCAGCTTGTCGATGGACGAGCTGGTGGTGACGGCGTCCGCCTTGGCCGCCAGCTCCAGCAGCTTCTTGATCTGGTTGGGCGTGAGGCC
GGGGATGGCCACGCCTCTGCCGCCTCGGCCTGCAGACAGCGGGGCGTGGGCCACATCTTCACTCTCCGACTCGCTGTCGTCTTCCTCCTCCTCGCTCTCG
CTCTCCTCCTCCTCCTGCTCGGCCGCCTCCCTCTCCATTCGCATCTTGATGCACAAGTTGCGGTGCGCGCTGGCGTGTCGCCGCTTGCAGATCTGCAGCA
GACACGTGGTGGAGTATAGCCGGTTAGTTCGTTATAATAGCCGCAGTTCTTTGCCTTCTTATTGCATTGCGGCCACGCACTTCGCTGCAGTAGAAGGCCT
TGCTGCAGATGGAGCAGCCCAGCGACGCGTTGGGCGTGGCGCAGTAGGCGCAGTCCTCGCCCGAGCCGCCCGCGAAGCCGCCCACCATGCTCGTGAGGCG
GCTCATGAGCTCGTCGTCGCTGTCGCTGTCCGCCATGACTCCTCTGTGGCTCCTTCCTCACTTGATGGACTCGAGGCTTCTTGAGGTCTGGGCAGCGCTC
GGCGCCGTTTCTCAGGTTCAATCTCGAGCCAAAAATAAGCCCATAGACGGGTCAGGTCGGAGCGCTTCGGCATCGAATCGGATGATGGCCCTACTCGGGG
GCAGCACTATAGATGGCTCATGGATGGCTATGAGCATTGAGCACAATCGGCTCGGGGTGTCTTACGCTGCTGGGCGGCTCCTAATCTTCCGCATCATCTG
GACGGATATATCCGTTGTGCCTACCTGCTGCCTGCTGCCTGCTGCCTGCAGTCGGGCAGCAGCTCGACGCGAACGAAACTGCGGAGCAGCAGGAGGCCTC
TATACGCTCTGGTCTCGTAGGCTAATTCCGCCTGCTGGCTGCACTGCAACTGCTGTCTACCAGAGCGTCGGATCAGATCGCCTGACCGGGGAGAACGCTT
CAACTTGCAGTGAGCGGTCAACAAGATCAACAAGATATATTGCGCGTTCTAGTCGAACTTTCCGAAGTCGATTGATTGAATCGACCGACAGCAAACTGCC
CGAGATTTTGATTTGACTTGAGTTTACTGTGTACGCAATAAAGTACGAAATAAGAAGTCGCTCAGGCCGTCTCGGTCGATTCCAAAAGACTTGAAATTTG
TATTCAGCGATTTCAACCCATATGGTAAACCGACCCGAATCGGCAATATTGGCCAGAATTCACAATAATAGCGGTGAAGCAGGTTTTGCTTGTCATAGTC
ATGGCGTGAGTATTGAATAAATATGCCAGGGAGCTTCCGCGCATTCTTCGATCGAACGCAGCGCGCTGCTGCCGTTTATAAAGATAGGGAGCTGCCTTGA
GGCGTTTAGGCCGCGACTCGAGAGGCCCGGGACAGTCGGCGCTGCGAGAGCATGCGCACCATGTCGGGCGACTTGTCGGTCTCGCTCATGTTGAGCAGGT
AGTCGGCCCCCACCTGCTCGCCCGTCGCGAAGCCCGAGAAGCGCTGGAACAGCTCGCAGATGGTGGCGTGGCCGTTGGCCTCGGCGATCATCATGGCGTC
GCTGTCGTTCTTGGTGCGCTTCTCCGGGTCGGCGTCGTGGCGCAGCAGGTACTCGGAGATGGCCAGCGAGCCGAGCTTGGCCGCGAAGTGCAGCGGCGTG
ATGCCGCTCGCGGTCATGACGTTCACGTTCGCGCCGCTGTCGACCAGCAGCGCCACGATCTCGAGGTTCTGCGACACGATGGCGGCGTGGAGCGGGTACG
TGCCGCGCTTGCTGCAGACCGACACGGTGGCGCCTGCGTCGAGCAGAAGCTTCACGACGTCGACGCATCCGTTGCGGCACGCGGCAATGAGCGGGGTCAC
GCCGGCGTCGTTGGCCATGTTGACGTCTGCGCCTTCGTCCAGCAGCAGCGCCACAATGTCCGTCCGGCCCATGCGCGCCGCAATGTGCAGGCACGAGGAC
CCGTCCGCCATGGCCGTGTTGGCGTCGGCGTAGTTGAACAGGATGAGCTGCACGGCGTACGTGTGGCCGATGCGGCACGCCACGTACAGGCAGATCTCCC
AGCGGCGGGCCTCCGTGAGGTCGGGCGAGTTGAGCTCGTCGATATCGACCGCGAACTGACTAAGCACGTGCTCGCAGAACTCCTCCATGAACGAGTGCAT
GGTGTGCACGCGCACAGTCTTGACCTGCAAGGACGGCAGCGTGACGCGCTCCGTCTCCGTGGTGTCGTCCTCTTCAGGCGTCTCTTCCTTTCGAGACGCG
ACTGCGCGTGGGGTGGCGAGGCGAACCTCGCTGACTTCCGACTCGCTATCGCGGTAGTCGCCGTCGTCGTCGTGTTCCTCTTCTTGGTTGAGCATCTGCT
CAGCGCACTGCTGTCTCCAGCCATCGAGCGCCAGCGGGCGGTGCAGTGCGGCCGACGCGCCGGCCGGGAAGTGCTCCGCCGCGCCGAGGAAGTTGGCGTA
CGCCTTGAGCACGAAGCAGCTGTCGTCCTGCAGCTTCTCACGCAGCGTGGCGCCGCCGAAGCTGCTGAAGAACTCGTGCAGCAGCACGATAAACGCCGCG
AGAGCGTCGCGCCGCTCGTTGACTGCGGCGTGGTCGAGTCCCGTGAACTTGGAGCGCAGCGAGCGGCGCGACGGGAACGGGAACGAGTGCAGCATCGGGT
ACAGCGCGTCGAACTCGCAGCGGTCCTCGGCGCAGCGGCACTTGTGCTTCGCGCTGAGCGTCAAGTGGTGGCGGTGGTTCGTCGGTTCGTCCACGCGCTC
GCGCAGCGTCTTCCAGAGGCGGCGGAACTGCGAGTACGAGCGCAGCGTGGTGCACACGCCGTTGGGCGAGAGCGAGGCCGGCGCCGCCGCACGCGCGTCG
TTCTTGGAGAGTTTGATGGCGAAGAAGACCTTGCCGTCCGTGACCTGGTAGCCGGGCACGGCCACGTCGTACTTGTCGATCCAGCTCATGGCGGCTCTGC
GTCTTGTTGGCGAGTGCCGGTCGGGGACGTTGGCTGGCTTCTGGAGGTGGAAAGCCGTTCGGAAGTTCGGTGGCGAGATAGATGTCGATAGGCTTTCGAC
AATCAGAGATATCTCGGCGCTATTAGTAGCGGATGGATAGATACCCCTCTACTCCGAGAATAGAGGTTCAAGTGTACGAGTCCGCTGCGCGCAGCACGAC
TACGTGGATCTTTCTGCGCGGCGGCAAAATGCAGATTGGCGCTCGCCCGTGCACGGCGGAGCTCAGCTGGCACCAGGCCGCGCCCCGGCCGGTGCATCGA
GCAGCTCGGCGCCCCTCGTCGTAATGTTGGACCGGCGCTCTGGTGTCACACCCCTTCAAGGCGCTGGCCAATGGGGGCTCAGTCCCCCCTTTCACAATTC
CACGCAAAAAATAAGCGGACGAAAGCGCACCGGCTCTGTCGACGC