Description :
From Genome Similarity Track
Location :
Scaffold_115:120402- 122791
Sequence
2389 bases(100 bases per row)
CTTTTTCCATGCAGTAAACAAAAAGAACATATTTCTGATTGATCAAAAATACTGTGTAAAATGTACCTCTTTTGCTATACATTCCACGGATAGCGGTTGT
CCTTAGAATGTTCAATTGGCGGTTCCCGCGTATTCTGTAATCGCCAAAAATCATGACCAGGCAGCTATATTAAGTGTGAACGTCTTGTCAATGATTTCTC
TACGATGATGTGATGACGGGGTATTCACTACCGGCTGGATTAGTTCACTACAGGTCGTAATTGCAATAAAAAGCTACTTACGCACTCTCCTGACGGGCAA
AAAGAACATCCCTGTGAGGTTATTGATTAATCTTCTGCAACATTATATATCGAAATTCCCCACTAAAAGATCGACAATTCAAGCTTCTACAAAAACGCTC
CTGCAAGTTGCCCACTTCGCATTTAAATCGTGCGTTCTACATAAAATGCGCATATTTTCTAACGTATCACCTTCCGTCACCCTTCATATGAAAAATTGCA
GCCGGCTTATCAACTCCATTGGTCATATACCTCACTCATATCACCTTCACGTCATTGACGTTTTTATATTTTTTAATTGAACGTGGAGAGGGAACAGATT
ATCGGTGACCGTAACAGCTCACTCTCGCTTACAGCTGTCAATAAAAGTCGAATTTCGGCATACAGTATATTTCATGTTCTAAATATTACTCTAGACCCGT
TTCCGCTGACAAAAGTATACGCCTACCTACACTAAAAAGTGTAAGCAGGCGTCTCGATACCTCACGCGTACACTGAAGCATTGAGGAAGCGTAAAACAAC
TAACACGTGCTGGCTAAAAATAAGATAAACGCACCGGTCCCAAGTGGGTCATTGTATCGGTATCGATTGGCCTGGCCTTACAAAAATTAACCATTCTAAT
TTTGAAGTACCTAATCTGATGCTAATACCTCCACCCTATTTCTTAAAGAGAAAAATGATTGCAGGAGCCGCAATCCTTTCAGCGCTGGCGTTGTGGTAAT
GTGGGTCAATAAAATGAGAATACGGAACGTCAGGATTAGTAAATGTTAAATGTAGTTGGCGGCGTCAGCAAAGTCATATATAGTGGCAGTAGCGGAGGAA
CGACAACGCAGTACCCCGTGAAATGGCAATAGCAGCGTTGTTAATGCGTTCCCGGGATTGAATAGTGTAGAAATGTTCGTGTACTACGTAAAATCCGTTT
TAGTACAGCGCGGTATACGTATAACGTGGCCAACGACGACGCCGTCCATAAAAACACCAATTACAAGGAAGACGCTAACAACGACGCTAACACTATGTAT
GCAGCCAGCATCTTACCCTGTAACATCAAAGGAGACCGACTAGCAGGCGTGATTAGATGTATTTATGACGACGGCGGTGAACTTCGCAGGAGTTTTTTGC
GAGCCCGAAGGGTGAAGCTATTAGTGACCCTGCACAAGACTGATTGCCGAAATTTTAAGATCGCACTTTTTGTGTGTCTGTTTGTAAATAACGCGGCTAG
GTGTAGATTACCCGTACTAAGTGCGATCTAGCCTGTCCCCCCCCGCAGGTATAGGTATGACCGAATTTACTCTTTGGTTAGGTCACTATTGTGGTGCAAT
AGTGACCTAGCCAAAGAGTAATTTCGGATGCTTCTGATTGGCTTAAAATCGATCATAGATGTATACGATCACATAAGCAAATGCTGGACGCTTATAAGCA
AAGACCGATCGCGTTGCCCTACCTTACTGTACTGGGTTAATACAGACAGTAACATCATCATACTCCTTCTTCAGTAACTCCTGGTGTATAGTGCCTTGCA
ACTTGATTCAATTCTCCGAAGCAGATTAATTATATCAAAGGGCGAGCTCCAGAGCTTGCTCCCCTATTTTATAATGTGTAAGGTACACCTAGAGTTTTTT
TACAGCAGACAGACACACACAGATATGAACGATTTAAATAGATTGGCATTCACCTTGCGCATAGTCACTAATAGCTTCACCCTTCGGTCTCGCAACTTAA
TATTGAATCAAATTATGGGGGTTACAAGTAATCCATTTAAATACGAAAGTAGAAAACCCAAGGAAATCGGGCACTAAACAAATGCCCCAATGGCATTTAT
AAAACGTCCTAGTACTCGTGATGACACACAAAAACCACATATTTAGTCATTTCTCAATTCCGAATTTATAATGGTCTTACTTAACCCCCACCATATAGAT
GTGATGGGGATGGCGTGCCACGCGTCATCATATCGTCGTCCGCGGCTGTAATAGCGCAGTCGGTTCTAATGTTGTTGTTGTTTTTTTGTCATGGAGTTGT
TTCGGTTGATGCAGTTGCTGCTGTCGTTGGTGGTGTTTTTCCTGCTGTTATTGTAGTAGATGTTTGCGTTAAATCAGTTGATTTTGTTA