Description :
From Genome Similarity Track
Location :
Scaffold_787:12040- 15080
Transcript NameFunction/comments
g11146.t1ETP49832.1 hypothetical protein F442_04735 [Phytophthora parasitica P10297

Sequence
3040 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTA
ACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGTCAGTCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCC
CATTTACAATCAATACAGTTCTCATTTTACCACCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTA
AGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAATGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCC
GTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAACCACGTCTGC
AACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAGCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACG
ATGTTGCGAACGCTATCACCGACGGAGCAACACCGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCAT
CGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGC
CATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTC
ACGGATCCTGCTTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGA
TCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTTGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTC
GTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCCATTGCGCTTGCAATGCAAG
AAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCT
CTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACA
GCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGCCACGGGCAATCAAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTG
GTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAA
CCTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAA
GGCTTGACTTCGAGGAAGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATAGTACGCGTACG
CTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCAT
GATCCGGTGGTCGACTGGATGAAGCGCACGATCGTGCGCTTTGGGAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTTGGCGCAGCACATGCACCACGTG
GTGCATGCGGCCCTCCATCAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGG
ACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTC
GAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCTCTGGGAGCCAACGCTGCAAGCAGTGCGGACGGTTGCAAACGGCCCGCACCGGAAATGC
TTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGTCCGCGGGTAGAACCCGCCGGCGAATACAG
GGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGCAAAGATGCGCAAGTCT
CGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTG
GTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTAATTTCGCTTCCAGTCACAAGCTGGAAGCGTTTCGCTTGCGACCT
GCACGATGGACACATCGAGCAGATTTTCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCAGCGCGAAGTCGAAGAAG
GAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATTTACTCCCGGACGACATTCCTGCGG
AGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGTCGGGAACAAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAA
GGCAATCGACGACTTCTTTGAACGTCGTCGCAAGGCAGGA