Description :
From Genome Similarity Track
Location :
Scaffold_676:1204- 5166
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_676-fgenesh-gene-0.0Glutamate synthase

Sequence
3962 bases(100 bases per row)
TCGGCCGCGGCCGCGTCGGGATCTCCCGAGGACGCCGAACTCTATGAGAAGCGCGATGGCTCCAAGGGCAAGATCGTCTCGGAGCGCGCGTTCCTCGAGT
TCAAGCGCCAGCCCGACGCGTACCGCGACCCCGTGGAGCGGCTTCACGACTGGGGCGAGATCAACACGGCGACTCGCGAGCCAAGCGAGCGCAAGGTCCA
GGCGGCGCGCTGCATGGACTGCGGCACGCCGTTTTGCCAGACCAATACGGGCTGCCCCGTGCACAATCTCATCCCCGAGTGGAACGAACTCGTGTTTCGC
GACGAGTGGAAAGAAGCCAACGACCGGCTCCACAAGACCAACAATTTCCCCGAGTTTACGGGCCGCGTCTGCCCGGCGCCGTGCGAGGCCGCGTGTGTCG
CGGGGCTCATTGACGACCCGATCACCATCAAGAACAATGAGTACGCGATCGTCGACCGCGCGTGGGAAGAAGGCTGGATCGTGCCGCGTATCCCACGCCG
CAACGGACTCAAGGTCGCGGTCGTTGGCTCGGGACCCGCGGGGCTCGCTGCCGCCGACCAGCTCAACCAAAAGGGGTACACGGTCACGGTCTACGAGCGT
GAAGACCGCATTGGCGGCCTGCTCATGTACGGCATCCCCAATATGAAGCTCGAGAAGAAGACGGTGGACCGCCGCGTGGACCTCTTGCGTGAAGAAGGCG
TCGAGTTTGTGACGAACGCCGACGTGGGCGCCACGCATTCCGTGCAGCAGCTCCAAAACGAGAACGACGCGGTCGTGCTGTGCATTGGCTCGACAGTGCC
GCGGGACGTGGGCGACGTACCTGGTCGCCACCTCAAGGGCATCCACTACGCCATGGAGTTTCTTACAAAGAACCAGAAGCGGCTACTGCTCACGGTGGAC
GGCAAGCTCCAGAGCGGCTGGGACCGCAATTTCGTGACGGCCGAAGGCAAGGACGTCGTGGTCATTGGCGGCGGCGACACGGGCACGGACTGCATCGCGA
CGGCCATGCGCCACCGGTGCAAGTCGGTCGTGAACCTCGAGATCAACCTCATGCCGCCGCCGTCGCGAGCACCCGAGAACCCGTGGCCCGAGTACCCGCG
AATCTATGGTGTCGACTATGGCCACGCCGAGTCGCGGGCTGTGTTTGATCGCGACCCGCGCGAGTACGGACGCCTCACGCGCGGCTTCAAGGGCAACGAC
GCGGGCGAAGTGACCCACGTGATCACGCAGCAAGTGGTCAAGAACCGCCAGACGGGCGAGGTCACACCCGTTGAAGACTCGGAGGAGATTTTCCCGGCCG
ATTTGGTGCTGTTCTCCATGGGCTTTTCGCACCCAGAGCAGGCGATCGCGTCGCAGCTTGGCCTGGATGTCGACCAGCGCCGGAACATTCGCGCCGAGTA
TGGCCACTACACGACGTCGGTTGAGGGCGTGTTTGCCGCCGGCGATTGCCGCCGCGGCCAGTCGCTAGTCGTGTGGGCCATCCACGAAGGCCGCGGGGTC
GCCGATGCTGTGGAAAAATACTTCTTGAACGAAGGCTTCCAGCCCGAGGTCGACCACAACCAGCGCTACGGATAGACAGCGAGGGGATCACTTGTTTCTA
CGTCAGCCTTTGGCGGCACGACGAGCTGCCAGCTAACCCCTCATTTACAGACCTATGCAGCAAACACACGGGATGCCATTCTCGCCATGACTACGGCAAC
GCGTCCCACGTGGCGAGACAGCGGTGGATAGATGGATGCGCATTCGCCCAGTGTATGTGCATTCATGCATCGTCTATTCCTTGGTCAATATATGTATACA
CTCGTAATTTAAAGAAACACTAGCTGAGATCTGTAATTGAGCTCTTCAACTGTCATGGCTACATTGGCTCTTCTTTGTCTTTCTTTTGTCACAGATCACA
GCTTGATGATCGGCACGCGTCCTTGCAAGAAGTGCACGCCCTGCAGCAGCGTCGGTGTCTTGGCGGCATCATTGCGGTCTTCGCTCTCATGCTGGTGGTG
ATGATGGGCGTTGTACCGCAGATCGAGGATGCGTACGCCCGTGAGCATGGAGACATCCCGCACAGAGCGACAGTCGCTCAGGTTCAGCACGTGGACGCGT
GCTAGCGCCGAGACATCACGCACGTTTTCACAGCCCGACAGGTTGAGCGAGTGGAGCTTCCCCAGCGCCGAGACATCGCACACTTTCTTGCAGTGCTTGA
GTGTCAGTGTATGTACCGTCGCGAGCGCCGATACATCCTCGACCATGTGGCAATAGCTCAGATCGAGCGTGTGGACCCGGGCGAGCGCCGAGACGTCGCG
GAGCCGCGGACAACCAGCGAGCTTGAGCACACGCACGTTACGCAGTGGACGTACGTCTTCTAGTGCGTCGCAGAATCGCATGTCAACTTCCGNNNNNNNN
NNTGGACAACCAGCGAGCTTCAGCACACGCACGTTACACAGTGAGCGTACATCTTCTAGTGCGTCACAGAATCGCATGTCAACTTCCGTGGCGTGCGCCA
ACGGAGTGACGTCTTGGATCAACGGGCAGCCCGACAGGTTCACACGACGTACACCAGCAAGCGCCGAAATGTCGCGCAGTTCCACACAGCGGTACGCGTT
GAGCACGGTCACACCTGTGATTCTGTCCAGGGTTTCCAGTGCGCGACAAAAGCTAATGTCTAGCTCATAGACATCGCGAAGTCCGTCAAGGTCCTGGATG
AGCTGGCAGCGGCTCAGCACGAGCTTGCGCAACCCACGCAAGTGGCCGACGCGAGCAATGCTTTTGGAGTTGGAGATGTCGAGTTCTTGCAATTTCCCAT
TGACGCCGAGCATTGAGATATCGGAGACAGCGTCGCAGTTGCGCAGGATCAAGACTCGAACGCCCACGAGGGCCGAGACGTCCCGCACGAGCTTGCACAT
GGACAAGTCAAGCGTGTCCACGTTTCCGAGCATCGAAACATCCGTCACGTTGGCACAGCCGCAAAGATCGAGAGACTTTACACCGCCCAACGCCGAGACG
TCATAAACACCCAGGCACTTGCGCAGCTTGAGGGTGTGGACGTTGCCCAGTGCACTCACATCCGTGACGTTGACACAGCCCGAGAGCGAAAGCGTCTTGA
CGGCCCCTAACTCACTCACGTCGCGAAGACCGATGCAGCCGCCGAGGTTGAGATCTTCGACGTGTCCGAGGCACGAGACGTCGCTCAGCTGCGGGCAGTT
GCGTAGATTCACGCACTTGACGCGTTGTAGAGGAGAGACATCGATGATACCCCGACAGACGTTGAGATACACAGCTTCGCACGAAGCGAGCGGTGCGAGG
TCGGTGACGTTGTGGCAGTACGAAAGATCCACGGTCGTGGAATGTTGGAGGAACGACACGTCGCGCAGTTGGTTGCAATAGCTCAAATCCACTTGCGGGA
TGCCGTCGAGATATTCCAGCCTATCCACGACGGCGCAGCCGCTGAGATCAAGCGACTGCAGCTGGCGGATCCCATCGAATAGTTGTACGCGGTAGATGCC
GGAGAGGTTGAGGTGATGGACTTGTCCCTGTGCAATTGCCTGCTTCAGAGTCGAGGGGCACGCATAGATGCTGGCCACGTCTCCTGTGGCATGTTGATCG
TGCGTGACCACGACGGGTTCTTCCTCAGGCTCGGCCGCGTCGTCGTTGAGGTGGCTGAAAATAGTCTCGTCGGCGTGCGTTTGCTGTGCTTGCTCGTCAT
CCAAAGTTTCCTCGTCTTTCTCAGACGCCGGTAGTGGCTGCAGTGTGACGTTCTCAAGATTGTGCCAGATCGATAGGATCTTCTCAAGACTCCGAGTCGT
ACAGACCAGCTTGGCGTGCATCCGGAGACGCACGCGATCGTGGACGACGCCGTAGAAGAACGAGTTGAGTTCGGCCAGCGAAACAGCCTCGCTGAGCGTA
AGCCACGGGATCAAGTGAACATCGTACAGCTCCATGGGGAACGCATTCTGGAGCCGCGATTG