Description :
From Genome Similarity Track
Location :
Scaffold_90:120379- 122213
Sequence
1834 bases(100 bases per row)
AGAGTTGAGCGCTTCTTAAATTTTGGATAAATCTGTTCTGGAGGACACAAAAGCAGCACCAGTGCGTGTAGTGGACATCAATATAGAAAAACCCTCATGA
TCCCTCTTATTCTTTAGTCAAAAAATTTCAAGATGTGGTGTGCCATGACCCACCCTCTGTTCTACCTCAAGATAGAGGTGTCCGCCACGAAATTGACTTA
GTTCCGGGGACTAAATACTGTGTCACACGATAGTGGACCTCGCCTAAGGAGCAATGTGATTTCATTGATGACTACTTCTGTGCCAAGCACGAGGCAGGAA
TGGTACGTGAGAGTCAATCTCCACATTCGACACTGACTTTTTGTGTCAAAAAGCCGAACGGCAAGTGGCGTATTGTGCATGCTTACAACAAGCTTAATGC
GGCCACTATTCCGGCACAGACACCAATTCCTCGAAAGGATGTTCTCCAAAACAACATGGTTGGTTGTGCTATGTATAGGCACTTGACTTGGTCGATGGAT
ATCATCAATTGCCCATGCGAGCGAGTGATATCCCGCTTACATCAGTGAGCACTCCGAGTAGTATGCTATGAGAATGGCTGGTGATACCCGAAGGGCTGTA
AAACGCACCAGTCACATTGAATTGTCTGGTGACGCAACGTTTCCGTCCCCATCGGGATTATGCATAAATACTTTTCTGACGTATTTGTCCATAGTCGTAC
CGAGCAATGTCGGTCGGATGTTAATAACACCACATAGGTCATTTGCGAGCTGTTCTAGATTGTATGCGCACGAAAGATTGTACGCCAACGCGTCTAAATG
AATCTTTGGTGCAGAGGAGATTCCTTTTTTAGGAAGTTTCATTGGTAAGCGCGGTGTCAGGGTGGATCCCGCTAAGGTCAATGTATAGTTGACTGGTCGA
TTCCTAAGAATCAAAAAGACTTGCGTATGTGGCTTGGCCTTGCCAATTACTTACACAAATACAGTGAAAATTACGCTGATATGGCTCGGCCATTAACTGA
TCTCCTTAAGAAGGACGCAGATTGGCGCTGAAAAAAAACCCATGCTGACGCATTTCGAGCAGTAAAGGGAAGTCTTCTCCATGCTCCCATTTTGGCGTAG
TCAAATCTTAAGTACCATTTTAGTGTCGTCTGCGACGCATCCGACTTTTCCTTAGTCAGCGCCTTGTTGCAAAAAGATGCTGAAGACCGAGAGCTAGTTC
TCGCCGTTAAATCTTGTCACCTTAAAGCTGCTGATAAACTTACTTGGTTTGAAGTATGCTCTTGTCAAATTTAGGGACCGATTGCTTGGCTCCAAGCCAT
TTGTCGTCTACACGGATTATGCATCGTTACGCACGGCGAACCAGTTGCCTCACATCTCCCAAATAATGGCTCCTTGGCTTTCCTTATTTGCTTAATATAA
CTTCGAGGTGAAGTACAAAACGGACAAACAAAAGGTGTCAGCAGATGCCCTATCTCGCTGTCTCGATAATGAGCGTGCTCATGTCAAAAACATGTCGTCT
CATATTGCGGAGTTAATTCGTGTGGCATATCCACAAGATTCTCAATGTGTGGCATTGTTTCATGCCCTTAAGAGTAATGAGTGCAAATACTCGGACAGTC
AATTTTCGGCACGATTGCGTGCCGGCCTATATTGATATTCAATCGATAATGGTCTCTTGTGCTATCGCACAGATATAACGAATCCTGCTCACAATGTTGT
ACCTCACGATGAGAATTTAAAGTATCGAATCCACCTTGCACCCATGATACTGCTCTCGGTGGGCATTTGGGTCGTGAAAAGACTTATGGGTTTGTAAGTC
AACGCTACTGGTGGCCCGAACTCTACAAATGGGT