Description :
From Genome Similarity Track
Location :
Scaffold_452:12037- 13776
Transcript NameFunction/comments
Phypl_g8475hypothetical protein

Sequence
1739 bases(100 bases per row)
GACAGACGAATTGGTTGTGGAACCGGATACGTAGATTCACAAAGTCGTCGATCTGCGAGTACATCCACCACTCCTCGCCTGACTTGCCCTTTAAGCATTC
CCGGAACGCACTCAGACGCAAGGCCTCGTCTAGTCCAACCGTAGCCTTCTCAAAGGCGTTACAGAACGTACGAGCCTTTTCCACGCTGGCACCGTCCGAA
TAGAAGGGTTGAATCATCCTCACGGCATTCTCGATCTGAGACGGCATGTCACCAAACTGTTGGCGCAGAACGGCAGAGTCAGCACCAGTCTCTCTACTCC
CGGGGGCAGCTCGGGGAACCTGGGGAGGGTTACCTCTCTGCGGCATCGCAGCATTCGTAGCCGTCGGAGGAGTAGCCACTCCAGCCGGCGGGTATTGCCA
CGAGCCCGTACTAGCGTCCCACACAGAAGTTAGATTCGTAACCGCTCCTTGAGGCGGGAAGTACGGATTGGTAAACCCGAAGTTAGGCGTGCCCGGCGCA
CCGCCAATCGTGTAGCCACCATATGAAGGGATTGCCGTGCGTACTTGCTTGGGGGGTTCAGACGTAGCAGGAACATTTGCCGTAGGCATCGGAAGCGGGT
TCGGATCGTACCAAACAGGCAGGGGCTGTTGAGGCGTCGTCACCACGTAGTTCGGTATGCTGCTGTAAGGCCAAGCGCCTCCACCAATAGGGAGCCCCTT
TCCCCGTGCAGCACCGTTCCCGGAGTACGTTCCTGCCGGACCACTCGACAGAGGCCCACTCGTTGCAGGTGCCGGTGACGTGGTCGGCAGCCGAGTCGTT
CCGCCAGAAGTCGTTGTAGGCGCCGTTCTTCCTTGAGCGACGCCTTGACTCCATGAGGAGGGGAAGGCCCTGTTCCACCGCCGCTCTCGCTTCCTCGTCC
AGTGCCCGTCACCGCTCTCTGCACGAGCGACCTCACTGTCCCCAATCCCGCTAGCGTCGTCAGGTCCGGGCGCGCTGGGTTAGCCAGAGGAGCGCTCGGT
GCGTCAGGCACTGTCGCACTTGGCTCCGAGGGCGCTCCATTTGCGACCGAGGGGCCGCCTGGGTCTTGAGGAGCAGGCCCTTGGTGGCTCACCCCTTCCG
AGCCGGTCACCTCGCTGACGGCATCGTTGAACTCAGCTTCCATCTCCGCGCCTTGGACTTCGGTAGACATCGCGTTCCCTATAGTCGGGTCTTCTTTTCT
CGAGGGCGAGCGCTTCACTTGGCAGGGCCGCAGAGATTACCGTTTACAGGAACCGTTCTAGTAGGGCACGACACGCGGAGATTCCGTACGCTTGTAGACC
TTCCGCGTAGACCCGTCCCTTCGAGTAGCAAAtgtgtcttcgtcgtcgagaaTAGAGGTTGACCGTCCAAGATTACTGTTCTTGGGTCGAACCGTTCACG
ACACGAGCCTTCACTTGACCGTCAAAAGTAGCTCACTGCACGGACGCCATTCACAACTCCCACGAGTCTTCTCGCCACAAGCCAAACAagtccttctcca
gcaagcAGATACCCTACTTCGCCACCAAATGTCGCGCACCTCCCTCTTCTGTGGGTCGGCTATCCGCGGGCTGTTTGGGAGTACAGGCTTGTTCAGGAGT
AGCTTGGAGTCCGGAACGCTTAGTAGTGGAAGTAGAACGCTTTGGAGAAATCTACAATCTCTCTCTCTTGAATCTCTCTTATGTATAGCAGGGAAAATGT
ACGACTGACTGCCCAACTACCTCGTCGGCTTTCCACCGA