Description :
From Genome Similarity Track
Location :
contig_82:120360- 123297
Transcript NameFunction/comments
g12651.t1hypothetical protein
g12652.t1hypothetical protein

Sequence
2937 bases(100 bases per row)
GTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCCCAAGACGCATGCATC
TGCTCAACCGGGCGACCAATCGACTTTCGTGGCTACTCGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGCTACACGTTCATGCTG
ATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGCCTGGCTATCCAAGAAG
GCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATG
ACCAAGAAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACACAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATT
GCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCACTTGCGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCAT
TGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGAT
TACGCCACCGACGATTACGCCACTGTCGATTACGCTACCTGTGGGTACAAGATTGTAGACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGT
AACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATC
TTCGTTCTACCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCCAAGATCCATA
CCTTCCATCACTCCGCTCCGTCAAGCTTCACGGTGTCAAGATCCATACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTGCCCACGACGCCTCC
ACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGGTGTGGCATGTCGTGA
ACCGAGAGACGACGCCGAGCTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGC
GGACTACCACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGACGCGCCTGAAGACGCTGTACGGTGGTCGCAGAAGCTGGTCGCATCTACCTG
AAGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGGAACGTGTTGCATCACTGCAACGAGGTCCTCAACATCAGCGCCAAGCTCAGCAGCATCGGCG
CCAAGATGGAGACGAGGACGTGGCGATCTGCCTGTGCGCAGTCTCCCCAAGAGCTACGAGAACGTCGTGCTGAACTTGGAGATGAGCAGCGCGGAGCTGC
GATCGCAAGACGTCGTGAAGGTGCTGACGAATGAGCACATCAAGCGGCAAGGCGAGAAGACGGCGACGGTGAAGACGGAGGACGCGGCCAAGGCGTTCAA
CACCGACCGAGAGTCTCGCCAGTGCACGTACTGCGGGAAATTGGGGCACACGATCAACAAGTGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGA
CGCGGCGGCAATGGCAATGGCCGTGGACGCGGGGCCAACAATGCCCAGTGGAGGAACGACGACGCCAACTACGACTACGGCTACGGCTATGATCGAGTGG
CGTTCGCGGTCTCACTGGAGTGTGGCATTTCGACGGGCAAGGATATGCTCGGCATGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAA
GGCCAAGTTCGCCCATTTGATTGAGCGAAACGAGGGCGAACTTTCGGTGGCCGACGGCAACAAGGCGGCCATCATGGGTGTGGGAACCATCGTGGAACGA
GTGGTTCTGCCCAACGGCGACGAGCGCGACATCGAGATCAAGAACGCGCTGTACGTGCCGAGCATGAGCAAGAATCTGCTCTCCGTGCCACAGATCAACA
AGAGTGGTCTGTTCCAAGTCGTGTTCGACGGCGCCCAGATGCGCGTTGCGCACAAGGCCTCCAAGCAAGTGGTGGCGGCGGCGAACCTCGTGGATGGCCT
CTACTGGATCCAGACGCCTCAGCGATCGGCGAATGCAGCGACCAGTGGGAAGACGGTCGACCTGCACGCGCGTATGGGTCACGCTCCGGTGGAGGTGCTT
CGCAAGATGATCGACAACGACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGTCAGCAAGGGAAAATGGTCC
AGAAGCCGTTCCCAAGCAACCGTGACAAGCGCCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGAGTCTCTGGTGGCAG
CAAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGCATCAAGACGTACGTC
ACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCG
AAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCATCGTCACGATCGGCCGCAGCATGCT
GCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAG