Description :
From Genome Similarity Track
Location :
Scaffold_18:12036- 13195
Transcript NameFunction/comments
Phypl_g789conserved hypothetical protein

Sequence
1159 bases(100 bases per row)
GTGACAATAGCCGCTGGCCCTTCTGGAGTTGTGTGGGAAGGATGGGGATCGTCGCTTGCTTGGTGGACCAACGTATACGGAGACACGGAATATGTTAACG
AGGAACTTGCGGAATTGTTCTTCACAATGAACGGTTCTACTTTAGTGCGAAACACGGACGTTCTCAATCTACCAGCGCTGGGACTCAACATCGCACGCTT
CAACATCGGCGGATCAAGTAGCAACGTCATCGACGATGGCGGGGAGGAAATTGCCATGAAAACGTCCAAGGACATGCTCGCGTACAAGACGGTGGAGAGC
TGATGGCTCGACTGGTTCAGCACGGACCCCAAAACGAAGTCGTGGAGCTgagacgccgacgccaagcagcgcaaaaTGCTGTCGCTTGCCGTCGGACTCG
GCGTTAATGTCCTGGAGGCGTACGCGAACTCTCCACCGTGGTGGATGACGAAGAATCGTGCGACTGCGGGTGGTGACAAAGGAAGTGAAGACAATCTGCT
GGCGTCAAACAGCGACCAGTTTGCTTTATACCTGGCGACAGTGGTGAGTGAGGCGAAGACGCGCTGGGGTGTCGCTTTCAACTACGTCGAGCCGTTCAAC
GAACCGATGAGTTCGACCTGGGAGTTCCCCGGTTCTCAAGAGGGTGCCATTTTCAAGTCGAGACGCAAAACGAAGTGGTGAAGCGCCTTCGCTCTCActt
ggacgagttcaagctGCAAACCGTGAACGTGTCGGTCTCCGACAAGATTTCTCCAACGCAAGCGTTGGCCACGCTAACAGGAATGACGGAGAACGCCACA
GTATTGGGAGCTGTCGGAAAGCTCAACACGCACGGAACGGCTGCGTTTCGAGGCTCGGACCGTGCAGCGTTAAAGAAAATGGCGAGAGACACGAGTTTAA
ACGTCTGGGACTCCAACTAcattgacgacgacgactctGGCCTAGCACTGGCACAATCGATCTCACTGGATATCAACGAGATGGGAGTTTCTGCTTTCGC
GTACGGTCAAGTGCTGAATAGTGGCGGCTCAGGCCTCATTCAGTCGAATCTTTGGGTGAACTGGATGGGCGAGGCGAACCGCAAGTATTACGTGATGGTG
CATTATTCTCGTCACATTCGCCCCGGAATGGAAATCTTCAGCACGGACGACCCGAACAC