Description :
From Genome Similarity Track
Location :
Scaffold_381:12034- 13535
Sequence
1501 bases(100 bases per row)
TCGACTTCATACTGGTTCGTACTTGTGTCTGGCTCCCAGCTGTCTTCAGGCAGTAATTCCTCGTCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCAA
TTAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGAACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTC
CAATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCCGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATA
AACAACCAGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTCCATCTTCGTCATCTGCTGTGTTGGGGATGGATC
TTTTCTCCTTCTTGCTCAGTGCTTCGTTGTGCTCTCGGGCTCGTCGTGCTTTCTCTCGCACTTGGAGCTCAGCTGCTAATCGAAGTGCCACTTCTCGTTG
TCTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCGCGTCGTATTGAACTCGTCATAGCCTTGAGCGTAGACTTG
GCGTCCCAATCATGTACCAGTTAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCGTCCCAGT
CGGCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGGCCGTTGGCTTGTGGTCGGTAACTCAGCGT
AGCTCTTGATCTCGACTGCATCATCTCGGATAACTTTTGGAATACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAAC
TGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCCCCGGTGTCATTCATAGCCTTAGCGATAACGAATCCCGTGAAGTGGTCCTGGAACA
GCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGA
GTAACCTCTCAACTGTGGCTTGCTCTTACTGGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGATCAATCCAGTAGTAGTCG
GCCTTGACTCGGTGATAAGTTCTGACGATGCCCTGATGCCCTCCTTCGATCGAGTTGTGACAGTTATGAAGTATTTCGTCGACCATAGTTGACGAAATCA
CCACTCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCCAGTCGGCGAGCTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTGAGTTCAAAGACTTCTGC
GACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGCCCTCAAATTCACCTCTCAGGTTCGCCTTCAGATCGGCCCACCTGAGTTCTTCATCTTGTGCC
T