Description :
From Genome Similarity Track
Location :
contig_82:120331- 125428
Transcript NameFunction/comments
g12651.t1hypothetical protein
g12652.t1hypothetical protein

Sequence
5097 bases(100 bases per row)
CCGCCACGCGCCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCG
CTACCTGCAAGGCCCAAGACGCATGCATCTGCTCAACCGGGCGACCAATCGACTTTCGTGGCTACTCGACGCGGACTGGGCCGGCGACCTCGCGGACCGC
AAGTCCACTTCAGCTACACGTTCATGCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTA
CATCGCGCTCAGCCTGGCTATCCAAGAAGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCACGAGACGGGACCCGAGCTCATGATCC
GCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACACAAGTACCACCACATCCGCGACGAAGT
GAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCACTTGCGGACCACGCCACACGGAGCTGACGG
CGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCC
GAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCTACCTGTGGGTACAAGATTGTAGACAAGATGGGCTT
CGACGTGGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGC
TAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCAGAGTGCTGCCCTCCCTCCGCTCC
GTCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCACTCCGCTCCGTCAAGCTTCACGGTGTCAAGATCCATACCTTCCATCAGGTTATGAGCCCAA
GCACCATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTT
CCTGACCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGCCGAGCTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCAACATCGCG
TTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGACGCGCCTGAAGACGCTGTACGG
TGGTCGCAGAAGCTGGTCGCATCTACCTGAAGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGGAACGTGTTGCATCACTGCAACGAGGTCCTCAA
CATCAGCGCCAAGCTCAGCAGCATCGGCGCCAAGATGGAGACGAGGACGTGGCGATCTGCCTGTGCGCAGTCTCCCCAAGAGCTACGAGAACGTCGTGCT
GAACTTGGAGATGAGCAGCGCGGAGCTGCGATCGCAAGACGTCGTGAAGGTGCTGACGAATGAGCACATCAAGCGGCAAGGCGAGAAGACGGCGACGGTG
AAGACGGAGGACGCGGCCAAGGCGTTCAACACCGACCGAGAGTCTCGCCAGTGCACGTACTGCGGGAAATTGGGGCACACGATCAACAAGTGCTGGACCA
AGCAGAAGGACGAGAATCGGGGCCCAAGACGCGGCGGCAATGGCAATGGCCGTGGACGCGGGGCCAACAATGCCCAGTGGAGGAACGACGACGCCAACTA
CGACTACGGCTACGGCTATGATCGAGTGGCGTTCGCGGTCTCACTGGAGTGTGGCATTTCGACGGGCAAGGATATGCTCGGCATGTGGGCGGTCGACAGC
GGCGCAACGCACCACATCTGCAACGACAAGGCCAAGTTCGCCCATTTGATTGAGCGAAACGAGGGCGAACTTTCGGTGGCCGACGGCAACAAGGCGGCCA
TCATGGGTGTGGGAACCATCGTGGAACGAGTGGTTCTGCCCAACGGCGACGAGCGCGACATCGAGATCAAGAACGCGCTGTACGTGCCGAGCATGAGCAA
GAATCTGCTCTCCGTGCCACAGATCAACAAGAGTGGTCTGTTCCAAGTCGTGTTCGACGGCGCCCAGATGCGCGTTGCGCACAAGGCCTCCAAGCAAGTG
GTGGCGGCGGCGAACCTCGTGGATGGCCTCTACTGGATCCAGACGCCTCAGCGATCGGCGAATGCAGCGACCAGTGGGAAGACGGTCGACCTGCACGCGC
GTATGGGTCACGCTCCGGTGGAGGTGCTTCGCAAGATGATCGACAACGACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTG
TCGCGGCTGTCAGCAAGGGAAAATGGTCCAGAAGCCGTTCCCAAGCAACCGTGACAAGCGCCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGG
CCCCATGGAAGAAGAGTCTCTGGTGGCAGCAAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGG
AGAGCGAAGACTGCATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGAC
CAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGG
ACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCC
TGCCGTCACCCAAGGGAGCACAAGACTCCATTCGAGATCGTGTACAAGTCCAACCAAGTGTCAAGCACATGCGTGTGTTCCGGATGCCAGACGTACATCC
TGACGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAAGGCTCGCGCCGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATC
GAGGCGGGGCAGGTGGTTGTCAGTCGCGATGTCAACTTCGATGAGTCGGCCTTTGGACTTTCGGCGCATACTTCGGATGAAGACGTCGATGATGCTGCGC
TGGACCTGGACGCGCTGGACCTGGACGACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAGCCGACCGAGTGGCGACGACGA
CACTGCCAGAAGATCGCGCCCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCTGAACCCGACGAAGAA
GAAAAGTCTGGGGACCAAGATGAAGACGACGACTCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGC
CGACGACGTTCCAAGAGGCTGTGAACGGTCCGGATCAAGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCG
AGCTGCCAAGTTGCCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGC
CTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGATCG
CCAAGTACTTCGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGT
CGAACTGGATGGTGGCTTCGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATG
TGCTCTATCGGCTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGC
TGATTACCGGGAGTTCGCCGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGG
ATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTG
TGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCT
GATGACCGCCACGCGCCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGCTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATC
TTTCGCTACCTGCAAGGCACCAAGACGCATGGCATCTGCTTCAAGCCGGGCGACAAGATCGACTTTCGTGGCTACTCGGACGCGGACTGGGCCGGCGACC
TCGCGGACCGCAAGTCCACTTCAGGCTACGTTCATGCTGATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCG
AAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAGACGGGACCCGA
GCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATC
CGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACCAAGGCGCTTGCGGGACCACGCC