Description :
From Genome Similarity Track
Location :
Scaffold_357:12033- 13122
Transcript NameFunction/comments
Phyci_149094Hypothetical protein

Sequence
1089 bases(100 bases per row)
GTCAAATTGTTGAGGAAGTGTATTGCAGGATCCACAGCGGCACAACACTGGCTGAGGTTCAGGACAGCGACCGCCCTAATTTGCAACCACTTTTGAAAGC
GAATCAGGATGCTTTTCTAACTTGGTCCACACGTTTCCGCGATCTGCTGACGATTCCTATGATGGAGAGACATAAGACTAACTTCGCAGAGATCCGAGAC
TGGCTGCTGAGCAACTCGCAAGCTACCCGTCATCTCTTTGCATTCCTCCCCTACGCTGAGATTGAGGCAAAACAATGGTCGGTGCACGATCTGCTCAAGT
GGGGCCGCTACGAATCTTATCGTGAACAAGTCAGCACTCTAGATCGCATTTTACAAGACGAAGGCCTCCCCGTTGATACCCGAGAGATCTGTGAACGTAT
GTACAATGGATGCTATTCATACCACCCGACGGACGCTCAGCTCACTCTTGCAGCCTCGATGCAGCACTGGGAGCGACTGCAACGCTGGGTCGCACGGGAC
CGCTGTCGTGATACTTATGTTGGCATACCGGATGAAGAGTGGACAATTTGCCTCATATTACCGCTACGTGGTTTGCTACACCTGTAGGCCACGTGCCTCG
TGGTGCTTGTCTTGTATGGCACCACGAGTACTCCTTCGTGGAGAACATCTGTTCCAGTATTCTTTCAACTGTGGACTGGATGCTGGCACTGAGGGCACCC
TCGGGGCTAACGTGGACGGACTGTGAAGCTGCTGGTATGCTTCACATGCGTTCCCACCACCACTAAGGGCTTGTCGGCCCACAACAAGGCGACGGCGGTC
CTCTCTACACCGTCCACCTTGGGAGTATCTGCAAGCAGCACGCATCACGCATTAGAGAATTTTTCCCCCACTGAGATGCAGCCAAGAGCCATCGAGCAGC
CTTCCAACGGCACAAATGAAGGACACCCAAACTGCGCAGACGGGGAGAACAAGCTGCTGCTGTGGACCACGCAACATTGACCATAAGGATGCATACCAAG
GAACGCGCCTATAGTTTTACTACCCAGAATGTGAGGGGTTTCGGAGCCACCGAAGCTGCTCATCGCGCTTGGTTACAGTCACTAGACCG