Description :
From Genome Similarity Track
Location :
scaffold_49:120329- 123128
Sequence
2799 bases(100 bases per row)
ACGACTTTAACCTACCTAGATAAAACGTTGGCTGTAGGCGCACGCGTGTAGGGGTTGCTGATGTATACGCATCGCCACTGCATTTCATGAACTtgaacgg
tccgatgaatcTTGGTaaaaacattctgcttcccaccttagacactgcatgttCAGGCAGATTTGCCGTGCTAAGTAGTACAAGATCTTTGTCCTTATAa
accttcttgttcttccttcCGCTCTTATatgcttgttctttttgcagatccTCAGCTTTCGCAATTGCGTCTCGAATAAACAGAACAACGGCTGGTCTCT
TCGCAataaagtcatcgacgtgctgttcctcacgacttgtcatgtcgtctagCGATCTCATTGAGTCGTGACTCTATAGCCATACTTCCTCGTCCACATA
AGGTAGAGACCTCGCCCATTATGGAGGCAGGTACTATCGGATAACTTCCATAGTTTACATGAAATGGTGAATGAACTGTCGAGACATGCGTGGAGTTAGC
GCAAACTTTGCAAGTGGGAAATTTTCACTTCACTGTTTAAACGACGTAGCGTAACTATGCAGTAAGACCTTCAAGACTCGATTCACACGCTCTGTCTGAT
TGTTCGTTCAGGGTAGGTCACTGTTGACGTGGACAATTTGGTGCCCAATAGTCCGAACAGTGCACGCAAAGTTTTGACGTAAAACGGGTGTCACGGTCAG
ACACGATCTCGACAGAAAGgccatgcagacggaaaacaaCATCTACAAAGATCTTAACTCTCTTCTCGACAGAGATCTTGTCGAAAACAGACGCAAGATG
AATCATCTTGCTGAATAGGTTCACTCAGACAAGGATGCCATtgtatcacgtggaacaccGAATatgaagtccatactcacagaCTTCCAGCTACCAGTTG
GTACTGCCAACGACGGAAGTGGGAGTTGAGTGGAACCCGATGGGTTTACTCCTTGGCAAAACTCACCAGTCCTCACATACTTGCGGTCCCACTTATAAAT
GTTAATCGGACAGACTGAGAAACGTCTCTCACATCCGAGATGGCCACCTGTCTTGCACTCATATAAAAGACGATGACGCAAACCATCGTCATTTTCAACA
ACACATCGTGCTGTATTCCCGTGTTCAACCGCATTGTACAACAATCCGTTGTGTACTCCAAAACGGTGAGCACACAATTTTATTCGAGACGAAAgacctt
gcagtgctttgtcgaAAGGGTTATTGAATATACCTCAACAAGTTCTGACATGCCTCATCAGACTCATATCctccgacaatttcttggcgCACTGTTTTCG
TTGCTTGCCCCCTGATCGTCTGAACATCGttgcattgtcgacatgactcgtGCATGTTTCGCTCCTAGACTTCAATTCATACTACGGACgtcttgacaac
gcatcggctAAGATGTTCGTCTTGTCTGGCTTGTAGTGTACAGCAAAGTTgtactccgcaaagaaggagaacCATTGAGCCATTCTTTGCGATACATGAG
AAGTTTTTACTGCCGTACGCAGTGAGGCATGATATCTATAGATCACAATGTGCTCCTCTCCAAGCAAGTTCACACGGAACTTAACTAGAGCATATTTCAT
TGCTAGAAGCCCTTTGTCATGAGCTGGATAGTTCCATTCCGCGGGCCGGAGTTGTCGCGACTGATACGAAACAACTCGCTCTCGATCCTCATCATCCTGC
TGCATCGCAGCACAACTGATGGCATAATCACTTGCATCGCGGACCACATAAAAGGCTTATCGTGGTTTGCAATCGCAAGAACAGGAACTTCTCTAAAGCT
CTTCTTTACTCCGGCAATTACCGCCTGATGATCTTTTGACCGTTCCCACTTAACGTTTTTTTAAAGAGTCGTTAGGGGTTGCATCTACGCTGCATAGTTG
CatgtgtatttgtgcaaatagttggccAAGCCTTACTAATGTCTCTGCTGTTCCGCATTGTTTGGCACAGGCCAATCATCGATAGCTTTGACATTCTTTG
GATCTACGCGAACTCCATTCTTGTTCACAAAGCAACCGAGAACGGGGATCTCTGgtgcaaagaaaatgcacttttttAATTATTTAGAGTTTATTCTCTC
GCATAACTTGAAGGACCTAACGAAGATGATCGAGATGAACATTAACATCTGACTTCTCACCAGTGATCTTACTATGTtcgaatatatcgtcaaagtaacT
CGGTGTGGACTCACTCAATGGGCGAAGAAGATTCGTGACCATTCTGTTGAAAGAAGCGGGAGCGTTCTTCAAACCGTGTGACATCACTAACAATTCccac
agcataccactgGGATTCTGACTGCAGTTCATTTTCGCGCATTCGTATCTGATAGAAACAATCTTTCAGATCGATCGCACTGAAAATAGTACTGCCAACC
ATTTCAGCAAAAATCATATCCTTGCGTGAGACCGGAGTCTGTGAAGGTATGGTCTCATCGTTCAATTTGATAAATTGTGGACAATGCGCCAACCACCTGT
GGCTTTCTTCACACAGAAGAGTGGACTGCTTACTGTCATGCACGTGACCAGCTTTCTATCGCTGCGTAAAGATCTCGTCAATTGGGATGATTTGTTCTTT
TGGTAACGGCcactgccgtgtgatacaaCACTTCGTACCAGGAAGTATGTCCATCTCATGACGAATGCCTCTGTCAGATGGCAATTCGTCCGGCACCTTG
TCTGGAAATATACAAGCATATTCCTTGACAAGTCCATACACGGGGTTCGAGCGTGAAGTTTCCCACGACTAATCAATAAATCTTTTCTTCCGTGTCTTC