Description :
From Genome Similarity Track
Location :
Scaffold_27:120306- 136398
Transcript NameFunction/comments
Phyca_LT153461460retrotransposon protein, putative, unclassified
Phyca_LT1534114675AF486809_1 transposase
Phyca_LT1534507361Hypothetical protein
Phyca_LT1534534695transmembrane protein, putative
Phyca_LT1534115100transmembrane protein, putative

Sequence
16092 bases(100 bases per row)
tgcacccagtcagannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctcgagggttgcccagagagaacacttcaccagtatccttcaaagtca
ccgagttggagtccagatccaccactgcccggaactgtctaagcgagtcagtcccaagtatcacgtccacatgcatctggtcaactactacgaacggtct
agtcatctctaccgaacctagtcggagtggcaagtccgctatgcctctaatctggagagggtgtccggacactccgttcaagtttccatcataggggcgc
aaggagtcacttgctttgccaatccgacgtagcaccttgcggtcgatcagactaaccactgcaccagagtcgataagtatgtccacagggacacagtcca
caaaacctgctgacactgcttcaactccacccacggagccaataatccgcttctctcccgggactacttcctcctcacagtccacttcagggttgtccac
ttccaccagaccagaccgtcgagtccggttattagtcaccaccggtgactcgctccgcgcggagtcactcaccacgtacgcgtactcgtacacactgtcg
gagttgtcgcgagtacactgcgaccccaactcctcagccactttactggacagtgaagtacagtcaaagcgcactgctctgtttcttgatcatcctttcc
gggagagctgcagctgcgcaggtctcacaccgttcttctcgttccttcaattttgctcgtatcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgacagatgaactggttgtgaaagcgagtcttcagagtcgcgaaatcgttgatc
tgggagtaagtccaccactcctcaccagtctttcccttaagacactccctaaaggcactcaaccggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ngtaggtgtacggttcacttgtccgacagtcgagtagtatccaggagtagcttgtccagcggagtgactcgtggctggcactagcatctggccgctcggc
acttgagtgtacgcactagtcacaggggcagtaggtagactcgacggttgactctgaagagtagacggttgactctgaagagtagactgttgagtccagt
acacttgttgaccaggagtcgctcgtgggtagctagtagtcgtaggcaccgaagtagtagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnccgtcttcgaatgtagtcacctgacacctccctagtcgaatcctgtcgttctagcagtgcagtgactctcgcgttcacaggtactgtagtaagttc
tctctttaagtgtagccgcccgacacctccctagtcgaaactgtcgttctagcagtgttcggcgcgcactttcacaaatgtccggtcttcttctccagtt
gataccttcgttgactgtagccttccgcggcgctcacaaaggggacccttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaggatcgagtacttgcgggctgttatatgagtagaggtccaggctgggag
cgttcggtaggcttagtatcaactaaaatgtaaaagtttgtttctcttgttgtttgtttcttagcaggtaaatgtacgactgactagtttcacgaggagc
tcacacagctccttaacacacttgtagggatgacacctcgccaacttgcttggcgagagctcttggagtgacttccatcctggtacgccactcgcgggag
gacctaagtggacctctggggtgaggtagacagggtagtagggatcccaacgttagtacttaacctcaaattcaagtttgaggttaattataggttgagg
ttagcaatcaacgattattaacctcacaaccacacatgtggtccacaaacacgtaaaatgggaggcaagacgcggacgacctgaatctacgttgtacgta
cgcctgtttgaagcttgcctggccagcacaagtgacttgaggttcgcgtgaactactgacctatgcctggttagctctgtgtgtggcacgagtgttggtg
gactgccatactacgcgagtaaactggcgaatatatacaagtggtgaactttgctacgtacccgagctgacaagcacgtgcgggcattgccattggacaa
tttgtcgtgatagtgtggcatgggacagcaggccacgggccagttgagatgctgtagacgcttgttaagcatgaagttcgctttatccgtacggccagga
tcgcgttgacaaactgatggcgaagcatctattttactactcagcagtggactgcaaggctaagtttcctcaagctctacaggagaaaaagatgtaactt
tacggtgctgttttttctgtgctgctctcgatgacgacgtcgacgccatgcaagtgcttatgcgctccggcgagactccagcgctgtgtctacccgtaga
tcgactttgaattgagcaccgtgtcgagtgcgtaaaccaacttgtggaaatgaagaccacccgcccgatgtatatttattgaagacgatgtagactctgg
cctcacacgatacgaatgggatggatttggatttatacttcaagagcggtctcactatgaatttcttccggtggtttcgtgaatggtcagcctggatacc
ctgagaaagacagctttgcacgtcactattctttatggagtggagatatggacaattatcaattcaattatccgcttggtgtttctacctcctactgtta
accctcggatgaggtcagcatagtgacgcagcttacgagcgaagcactttacgttagctgaattcttggattatacaagtgatatctactggaaatgggt
ttcgttctgctcgaactgggaaatgatactgctaattggtacactaaacccaatccttcgcagcttttagtagtgaaggcttgcttacggatgaaactcc
gctctacaggaaggtgtcaacgtacgaacctcgctttttgtacatcggtgtacgcgatacggccatccactgccccccccccctttccttaactggccgg
taaaaacattgtatctggaagtgacgtcgatcattaattaagaaagaaactatggacaatggcaacaacaaacacatagagagctcagtttgatcatttg
ttcgaagcgcttaccaattgactggagtacatgtgcaagttatgaattcaatggacatttgcgtgcagtaccttattggttttctgcgatgaaaacgaga
tcgcgcacaagacttggatcaagttggctgcgcttagtagtcaccgtattgcctgcggtcgagaatgctcgctctgacggaacggaggttgcaacgcacc
caagccacttccgtgcgagagggctcagggttggatactttcggtgattaacagaccaccacttcagcggattctgttttctttccaccgacttcgcgtc
ttcgagatattgctcaaactctgccttacaccgtgttcgagtcagttggaagcctgaagacgcatcgtggacgtcgtcgacatcgcaacagtcgtcgtca
ccgaggacatcatcccatacatcagctgtgttatcacttggtgatcgaagtggggcaacactaggaccgccggatgaactggttgactgttgttcagctt
ggttttccgcgacagtaaccgcagcatcaatcaggcatcgttttgccaagcgcacttcagaagattgaagaaacttcattttgtgaaaccttgggtccaa
gtatgttatccacaggagatccgtgtccaaggcggaaaatctcgctataaaaagttggagaatcgcagcgcgaaccttgagcatgtgctctaccacacgg
tcacgatactcttgttcgccgattaacgcagcggcgtcatcgaagattccaggcctgcttagctttgccttaatacgtctcagcatcggaaacgtcagtg
ctagtgtcggatagttttccccctccagtattgtggtgacggctgcaatcggattcagcagtacaagtaaacacttcgccgtgaaccactcagagggttt
tggcctcttctcaggactgagatccggaaactctttcttgccttcgtcgttgagcaatcgactgaagaagtggtccaaagcaggctccagctcaatcatt
cgtgtcaacatatcgcgacatgagttccacctggttggacagtcggtgatcacttgaagtggcttctgtttcaatcgttttttctggatttcatcaagcc
gatgagttcctttcgatgacttgtggaagtacacagcgacgtcgcggaaacgctgtacggttttacgaacttcgataagggcggacatagcggtattgga
gtcagtcggaagtgcttgtgaaagaaacgtgtcgacctcttgtagggcctcatcttgaagccactcaggtgcttctgtgtctgctggcccattttcttca
gatataccttcagcggttgcaaccctggccactgaagcatcgggtagggaagcaaacccaggatcgagatcggcggtggaattttgagcttgtggtgtag
aaatatcagccccagctttcttcttttgtttaagaagagcgcctccaactaccaagtgcaatgaatgcgcaatgcacgacatgcttcgcatgtcgagaat
ttcactagcacacacagcattagcagctccatctcgaacaagcatgacgcaattttcaggtcggagctcccatcgagccattattttctcgagtccttta
gcaattgcgactccggtgtgtcgcccaggaaatggctcaacttcaagagtccaactggataccgtaaagtcttcctccaagtaatgaatcgtcaacgcca
tgaaactctgcgcccttcgacttgtccacacatccgtggtcacacagaaatataggcagtgagaatggatgagactttttaacgtagctcgtagctcaga
ggctagaatgccgatgtccgctcggagctgagtcgatccaggcaaagctgcactcactccacccaggtcttgagtaacatattcaaaaaatttgatcagc
ccaggatctttcacgatagtcagaggtctcaaactctgggcaatccaactagcaagtaatttgttcactttggcttgctcttctttggtgaccgggacta
gcgttcgccgtttcgtgccaggtgcatctgagtaagcattttccagccttcgtttcgctgcagattctcgggcagcgtcttccttcgccttgaccagatg
gtccatgtggaatttttccatatgcgccttaaccgcatttgtggagccatgactgtaatttactcgagctttgcagtttttgcaataagcaaacgcggct
tctttagatgtaagcttctttttcggcatgccctcgaactgtgacttcggaacaagacgaataaaagtccaccgggccttaaagcgttggcgtttcatct
tgtagagtacagcaggtcgttccatcgtttgaagaggagtctccgcatgaacacgtcgaacttgggatccagggatgtcaggtcgtcctcgaccaactgg
tgcctgccttgtcgctgacgaacgatctcgtgatgccacacctagccgttgaacccgccagcggtctgtcgacgaaaataattggggtgtggaaggtgac
aactgcgccgttgacatcctggatgatacttggctgaaagatgagacgttcgtgcgcgattctgtttgcggaccgcgtcttggtggctgttcgtacattt
gagttgtagggcgctgaggcgttctaaacccgtacgctgaaggctgggccggttggccgggatcttccgccattgtggttaagtttcagtatgagcaaaa
tgaaaaatgtcgccttcccaaattaagaggggctgtttgagcgaacttgtagttactattaaaatgatcacttattataggacaggaagagtgcacaaag
atgtttagtcaacctcagactgtcttcaacgtcaacgtcaacgctgaggttagaatcagttgacgtgaggttaagaccttaacgttggaacccctacagg
gtagttcactctagtagacggttgacacatacttaggccagtgagttgtcgaaacactccgagagtcgacgcgacacattgtaaggcctaggggcatggt
acacacaccgactcctctggttcaccactggtattcccgggtacgggacactgattgcgttttggtagcttgaggaatacttgtcgtcgatccagatcga
tgacgacgatccggctttcctgttcgactggcaagaggacaacgtgaacgcgttcgtggctgcggcgaacaacttgcctacagctgaagcaccaccatgg
ttgcgaacgcgaccaggccgtatcacggccagctcattgatagacgatatcatctacagactccaaccagatgcaggggctcgctgtggccatgtgatgc
tggcaccaaataaccaggaacagttcctcgctattgggatgacgcttggcaacctacaaaatgatacattcttgcagaatgccgcgcagacagcgattcc
ggtggtgaacaatgttgagcaatacctcgccgtgacgtatcaccttactgactcaagagtgcaccaagcgcgaccgaacaatctcccaccgaatctccag
aatggaaacccactgcgtcggctcttcatctaatgcgctgtcaatggcagcgtcatgtgtgcgcctactgaccccacatcacatgtgatctgaggagtca
gtcacccatttcaaagctgctgcatcttacgttagcagcagtgtgagctagatagcatctagtaagtacttacattaattgaagttgatgtcgttgcgac
cagtgttcagatagcttatgatggttaatcatcggcctcaaacaggccgctgtgacttcatcgcattgtagaattacacaaaaagatcacacatagatcg
tctcgatgccatcggtaaactacgtactcgcgctcagtgcgtcatgaacaacggattgccaatcaaggaaagttcatttaatactcagctcacgttagat
agtttttagcttcacaagtaatgcaagtagaactagcaaccttcgccaccagcaatgaccagacaagccgtggagtcgtagatgctcatgatgttggtca
tgaccgaccacacgggggcaaacacgaggtagatcacactattgacacccatcacgtagctcgaaccgccaagacgcttcatcacctgtgtctgctcctt
ttggcgaggaagcatgacaaggaacaccaacgagaacaagttgactgcgtacatgatcaggaccgtgtacgtcacgtcctgccttacttcgtgggtgtca
ttctggatccgttctgtcgacaagtcccacatgctatcaacgttacgggtgatggcagcggagaacggagtgcagaggttgtagaccgtcgtgagtagac
cgtacatggctccttcgtggccttcagaagacagctctacgataatgaaagagcccacgatgtagatgattccctgaggaacttgctgcagaacagggat
tccgagccagaaccaaggcgaacgagtgacatcccagatcgtcaacaatttgactgtcgcgtcgagtgccaagttccagaccatagtcaccactgttgtg
cgtcgccagtcccagtcacggccgtaattaccagcgaaccagactgacatggcaaaggcaccagtagtgaagaagccggcgattttctcggcgagaggtg
acacattcacccagttcgtctgaataggcatggcggatacccacgtgaacatggcaaaaatgcccgagatggtctggtacgcaatgtactggtacacagc
gcgcgtctgcacgatatcccaaagctcgcacatgtagtgcttgaagttcttgtggtactcgggacgtcgctcctcgtagataaacatccaggtaatcggg
accattggaatgagagcgactgccacgatgagcatgagaatcgggaaagacagcgagaagtcgaagtctccgccatactcctcgccattgaagcagaaag
caacaagaattagagcgaggatgttgaacaaataccgggtggtatagatcaccgtctgggtccgtccacgaatttcgagcggctctcgttgagccagctc
aacgacgataccatcagcgcagacatcggacatcagataaccgaagacgcaacccatcatcggaatgatgtacaaggcaccctggttggccgcatcgtag
ttaatggtggcaacgatttctggcgtgtattcctcgggcttgacttcacggtaagaaggatctgtgaagtacggccgaccttcaggtgtcagacccattt
ccagcagcatggctagagttacgatccagcctatgaccatgtacggacgacgacgatatccccaaagcgggaaacagtccgagacaatgccgtagaaaac
cttgaaactccacggcagctgtaccatgacggtggctgtcgtcgtttgcgagcctggaatgttgaggtagttctgtagaaacgggtaaataacgttgggc
agcacgccatcgataaagccgacggcggcgtactgtgccacgagtccaatgtattggcgagagaagaggttcggagctcctccgcttcggagagctcctc
cttcgatatagtcgtcgtacacgtaacggagcttgtcatagtcgtgtgctggcgggtcaagcggtgacatgctgcaccgtgactcacttaacattgcagc
gctgtcggggttgtaaagctccaccttttcgtccggtagaggcatttcgaagtcggtctccgttaacgtagtgtggctcatgcgctggggcacgcgaatc
ggaaactgcaccttcaagggctccgcttcatcagtactgtagatcacgctgaaaagaggacggcgccgacttccatgctggaatgcaaaggccggacgac
agtgccgtcagatttgcagagctagtgggtctccctcccatactaacgtccatattgtttgccatcatccaaactttctctgaacagaggacaaaacagc
gggcgccaaacacacgcaagaaatgcagcacttcggtaggcgacacaaccgaccgtttgtagtgaaagaagagcctaaggggcgaggacgagtcctcgga
gacggaatgcacatggtatttcggcatgggctgctattgtcagtcgactcactctgaaaattagacaaatttctccgtcacctacacgtacagtgcactg
caaagcaacacgtgtgtgaaccagttggaggatacatcaactgcgtcggttcctgagaactgaagagagcagcttcggctggtagaggatgaccgtgatc
gaccataaggtctctgctaaacattttctggatcttcatgagtcaggaagtgcaacctcttggtgaagaataatgaccaaggacgcagctcaactcaact
tcagcttaagtctaacctttccgacctcaaaggtattgtacttcagacttttcggtcgtgtattatttggccggtattcccacgttgcagtgagcttgcg
gtgcatgatgcaacttttgttttaccgcagtgtcgtgcagacgaacagtaagtgtgtccactgtttgaacagtagctctgcaagtttatccgataccatg
gtacagttcatgcggttgtgtcttcatccagcactctaagttagagtctaactacactaccgtagagcgttctatcctaacttacagtatgaactgcaaa
accaacagagacatggcaaagtctactggccaagatgaccgcaaacagaaccggcatcggacgacgcgaaccggctcggtcgacttgacaatggccacat
gaacgccagggcgtcattgcttgagcgattggtgccgttgggaaacactcacgatttgaaaggcctgcagcgctgtacagtatacaaccagagagaccgt
ggtcctcaacgtcctcacccatgccgggactctcgacaacgcgaggttacgagagaggaagtccgctttggcagatggcagcgtcgtcagtgtcgagact
tccaccttgatttgaagtcgctttcgttcaacagcgtgcacctccaaagaaggacgaaaagtgccgcagacatcgagctcgccccgcttttcatcacctt
cagggcaaaaggcagccatgcagctgccgtatgcttagcttaggctgtgcgtgttggttggtcgtcttggaatgtttttgctaaaatggtaggctatcca
agtttgttggatagcgaagctacatacatgtacaggcaggtgcccccaccgattttggtgcacgcggtgccgcagcattagtcaatttacgctgtcagcg
cgactaatagcggcgagggcggtggtgccagattctagggactgacaggttaccgcgatgaaagcaggtcggacagacacgttaacttcacagcaggcac
ctatcgagttgtacagcgaggactcttgctcgtggatggttacggactcgccgcaggatgaatctccgttccccatggtgttcgaggaccaaaagatgcg
ctacgtatacgacgactacgtcgaaggtggtgcacttcggagcggtagtatgccaaagcttttctcgcgaaagtactttggacttgtggcgcaatacgca
ggcgtcggattcattgacggcgtgcttcccaacgtcatctaccctttcctgcagaattatctcaacttgcccggatcccagaccaccacagcgttcgtgc
tcgtgcagatgccgtggagtttcaaggttttctacggcattttgtccgactgcttcccgatctggggttaccgtcgtcgaccgtacatccttggtggttg
gattttcgcgctgatcatgcttttgatactttcattcactcctgaaggcaagccgtacttcacgaatccagagtatcgagacgtaaagcctgaagactac
acgcccgaaatcatcgcgacgatcaactacggtgcggccaacgacggaagtctgtacattatcccgatgatgggatgcgcctttggatatttgctgtcgg
acgtgtgtgctgatggaatcgtggtggagctggcgcaacgggagccgtacgaggtgcgaggcaacactcagacagtgatctatacaacgcgtacagtatt
caacatgctagcttatatcctgttgggattttgcttcaacggagaggaatacggcggggacttcaacttctccctgtccttcccaatgctcatgttgatc
gtgacaattgtgctcgctccgatcgtgccagtcacgtggttcttccttcatgaagagaagaatgctttcgctatgaacttcaaccactatatgcacacac
tctgggacgttatcaagacgcgtgccgtgtatcagtacatcgcttaccagttcttctcgggcatcttcgcttcattcacgtatttgtccaagaatcccat
catgaggaactgggtgggcgtctcgcccattcaggagaaggttggcggactcttgtcgactgctatgtacgcgacatccatttatttcgctggtaactac
gggcgtggttgggattggcgcagaacggcagcactcacgatggtctgctacgtgacactggatgcttttgtgaagctcatgacgatctggaa