Description :
From Genome Similarity Track
Location :
Scaffold_1524:1203- 6268
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1524-snap-gene-0.0ATP-binding Cassette (ABC) Superfamily

Sequence
5065 bases(100 bases per row)
GGGCCTTGCTCGCGAAGAACTGGATCATCAAGACACGCCACCCGTTTGCGACCTTGGCCGAGCTAGTCAATCCGCTGATATGCATCGTACTCTTCGCGGC
ACTGAAGAGCATGGAACAAGATCGACTTATACCAGCAGGGTGGTCATTTCGAACGCTCAACGTGACCGCACCAACTCCCCAAGGCTTGCGCGCGAATGTG
TTCTCTAAGAGCTACATACCTGTCTCACTCAAAGAGCGTATAGCTGCCAGCGTGCACCAAGGAACATCGGAATGGCGTACGTCATCATCGATGTCAGCGT
TGTCCATTCTAGCAGGAATCCCGATGCCACTGTTTTATTTCACAGAAACCACGATGCCGGGTCTGCTTATTAGCTTGGGGCTGCAAGCTGTGTTGGAAGG
AGATCGCTTGGACGAGTTACCTGATGAGGACTTGTCGTATTGCCTTTCAAGTTTCATCCTGTTTGGGCACACGAGTCTAGACCCCGAGTCACCGTATTTC
ATCCCTGCCGAGTGCAAGCGCAAGATCGTGCCGTACAAGATTGCTATCACGCCCGACACGACCTACACCAAAAATTACTTTTCTGCATTGATGGAGAAAT
GGCATCCTCGGATGCCTCTCGTGGCAACAGCAGGGGTTTCTTCGTTCGAAATTGCTTCCTTCGAGGATTCGCGGGTATTCTTTGACAACGAGACAGCATT
GGAGGAATACATTGCAAGTGAAGAGTATGGAGTTGACTTCGCGCATCCAAAAATTTACGCAGCGATCGCGTTCCAAGAATTTCCAAGAACGAGTGAGGAC
ATTGGCGATGTTCATGGACACAATATCGAGTACTCGCTTCGGCTGAATTCCACGTTTATTGATGTCAAATTTCCAGGCAGTGTGCCTCGAACTATTGGCA
ACCGCTTCAAGGTGCAGAAGCTCCAAAAAGAAATCAGCCCTCAGCAGACGCTCTGCTACGCCACTCGTGGGTTTATGACACTTCAAACTGCCGTCTCGCG
ATTTTTGAACTGTTTACCTTCGTGGGATGCTGCTTCCGAGACAACCGATGGTACCTGTCAACTCGCTGAATCAACCATGGCGTCTAGCGATAAGCAATTG
GACAATCGGCTGCTGAAGCAACTTGAGGACGACCTGATAATCAGTTCTGTTTTTGAAGTGGTACAAGCAACGCGCGATGTTGCTTTGACGGAACCCAACT
TTACCGATCCACTGGTAAACCTCCTTCAACCGCTCAAAGTTTTATCGCTTACTGCTGACAGTATTCCTGAGACGACGAAGAAGATGCTTCTGAAGAGTCT
GCGGCAAGCACCTCAAGCGTACCATGGCGCTGGTGCATACGTTAGTCCGACGGACGCCTTTGTGTATGCGGGCTTTTATAACAAGATTCTGGCAGTATTC
CCGATGGGCTTCATCTTGTCGTATTTGTATGGAGTCTCGCGCATCATTGCGGCCCTGCTCATAGAGAAAGAAACCAAGTCCAGAGAATTGATGCGCATAC
TGGGGACGGATGAGAAGCAGATTCTTCGCGCGTGGTTCTTAACGTATCTTCAGCTACTAGTGGTGGCGTCACTTCTTCAAACTATCGGAGCCAAAGCGCT
ACTATTCTCGATGTCGCAATTTGGCCTACTGTTTGTCTTCTTCTTCACCTTCGCGCTGAGCAGCTTCGGATACGGATTTCTGATCAGCAGCTTATTTTCA
CGAGCGCGAACAGGTTCGTTTTTCGGTATGGGAGCATTTTTCATGATGTTCTTCGTGTCGTCAAGCTTCGGTGAGACATCGGGCGTATCAAAACGAACGT
GGGCGTGTTTATTATCTCCTGTGGCATTATCCCAAGGAATAAGTTCCATTGCCCAGGCAGAGTCAACTGGTACCGGAATCGACTTCGTAAATGCTTATGA
GCCGACCGGAGGATTTCCTGTTGCGAATGCGATCTGGATGCAAATATTTGATTTTTTCCTGTACGTGATTCTGGGGTTATATTTCGAGAGAGTTATCCCA
CGTGAATTCGGCGTTACAGAGAAATGGTATTTTTTTGTCACGAAGGCGTACTGGCAACAGTTCTTCAAAGATGATCAGCAAAACGATAAGCTACAAACCA
AGTCCGACTGCCTGACGATAGCGCTCGGGAAAGATGAACTACTCGCCCAAGTCATCGAGAGCGTATCGGTAGAGATGAAACAACAAGAGCATGATGGGCG
AGCTGTCGTGATTGAGAATTTGCGGAAAGAGTTTGATGTGCCGGGAGGGAAAAAGCTGGCGGTGAAAGGTTTGAGTTTGATGCTCTATGAAGGTCAAATC
ACATGTTTGCTGGGACATAATGGAGCAGGCAAGACCACTTTAATGTCTATGCTTACGGGAATGCTTCCTCCAACGAGCGGGACTGCCTGGGTCAATGGCT
ACTCGATCACGAAAGACATGGGTCGTATCCGCCAGTCGCTGGGATATTGCCCGCAGCACAGCGTTTTGTATCCAGAGCTGACAGTGGAGGAGCACTTGCG
ATTCTACGGCCACGTGAAAGGACTGCACGACCCTGTTGCCCTGTCCTTGGAGGTGAAGAAAAAGATCGAGGAAGTGGGTCTAACAGAGAAACGTCATGTG
TTATCCCACGCGCTCTCCGGCGGCATGAAGCGGAAGTTGTCGCTTGCGATCGCGCTTCTCGGCGATAGTCGGGTCGTGTTTCTTGATGAGCCAACATCCG
GAATGGATCCATACAGTCGGAGAAGTACCTGGGAGCTGATTCAAAACAACCGACGAGAGAGGGTAATGATTTTGACGACTCACTTTATGGACGAGGCCGA
CATTCTTGGCGATCGCATTGCAATTATGGCAGACGGTGAGCTCAAGTGTGTGGGATCATCGCTGTTTTTGAAGAACCGATTTGGTGTCGGGTATCGATTG
AGCTTCGTGCAAGCGCAGAAAACCAGTCACTCAACGCCGACAGAAAGCAAGGGATGCGGAAGCGCACAGTCACTGCATTCATTAATTCGTCAGCATGTTC
CCAAAGCGAAAGTGGATACAGACATTGGTACGGAGTTGACTTTCCAGTTGCCATTTGAATCGTCCTCGAGCTTTCCAGCGCTATTCGAGGAGATTGAGTC
AAAGCAACAAGACCTTGGGGTGTTATCGTTCGCGATTTCGGTCACCACACTAGAAGAAATTTTCCTCCGAGTCGCCGAGGGAAAATTAGCAAAGCAACCC
AAGTCCAGGGATGCTATTGCTGCGGACGATAGAGCTGTATCTATCCAGATAACGGAATCATCGTCACCGCCCGAGAAGGAAAGTGAAGGACACGGACAAA
CCAAGGCTCAGCTCGTTTCTCAGATATACCCTGTATGGTTTTGTCTACAGGTCGCTGCACTACTTCGGAAGCGCGTATTGTGTGCAAAGCGAGACCGAAG
TATGTTGCTTTTCAGCATTATACTGCCGATTGTGATCGTTTTCGTGGGGCTATCCGTGTTGAAGCTGAGTGTTCTTGTCCGAAACGATCCGAAAGTGGTT
CTAACGATTCAGGGTCAATACGAGAATGGCGCAGAAACACCGATACCGTATAGTTGTCCTGGGACGTCGGCGAATGATTCGTGGTGCACAGCTCTTGTTG
AATCTCCATATTTCTCGAGTGGAGTACCATACGCCATTAAAATGGAAAAGAGCGTGTATAATTCGTCTAAAACGCCAACAATATTTGGCTTCCCATACAG
CAACCCATCAATCAAGCCGAATGACACAAGCGGATACTGCTTGCGCTTTGCGGAGCTGGCATTTGAGAAAGGGTATGGGCATAACTCGTCAACGCAGACG
GTGCAAATGCAGCCCGTTGAAGGCCAATACGGAGGGTTTGTGCTCGGTGGTTCCGAGAGAAGCAGGATCCTGGGTTACAATGTAATGGCTAATTCGTCAT
TCATACACTCTGCACCAACGTACAAGGCTGCCATAGACGAATCCATCCATCGTTTCCTGCTTTCCAAGACGGTGTCCAACTCCACAAAGAACGTCACAGT
TCGAGTGGCTACGCATCCGCTCCCGATGTCATTCAAGTCCAGATCCGTTCTCAACTCGATACTAGGGTTGCCTGCAACGATGTTCATCGTGATCGCATTT
TCGTTTATCCCGGCATCGGTCATGCCGTTTCTCGTCAAGGAAAAGCAAAATGAGCAGAACGCAAAGCACCAACAGATTCTCTCGGGAGTATCCGTGGCTG
CATTCTGGATCGCAAACTTCATCTTTGACATACTGTTGTACCTGGTGCCGATGATTGTCACAATCGTGATTCTGAAAACGTACAACATGATTTCGTCGCT
CAGCAGCCACGGAAGTAGCAGTTGCCCAGGTTGCACCCAGGATGTTTTTGATGCGGTGTTGAGTCTGTTTTTCCTGTTTGGTGGAGCGATCGTGCCGCTG
ACGTATTTAGTATCTCATATGATGAAGAACCCAGGAACATGCCTCCTCTACACGGTCATGCTGAACTTTGCGCTCGGTCTTCTGCTGATAATCGTGAGTT
ATGCACTGAATGCGTTGGAGGTGACCGTGGCTGTGAACAAATCTCTCGTGTACGTGTGGCGATGCTCTCCGTTCTTTTCGCTAGGAAACGGTTTGTATCG
CATTATTATTGCAGATGTGAAAGCGCTTTATGGTTTGTCTGAAGGCGGACTAAGTGCGTTTTCGCCAGAAATCGCTGGTACCGAGGTTGCCTACCTTGCA
GTGCAGGGTCCGCTCTTTTTCACCCTCGTTCTATGCATCGACTGGATCAAAACAGGTGAGTTCAGTGAATTTGGAAGCCGAGTGTGCCTGATCAGCTCTC
GTTGGCATCGGTTTGTTCGGTCATACCGAGGTTCCAACGCAAAGCTTCATGCAGATGGTTCAGCACCAGCATATGTCGAAGATGCTGATGTTACTGAGGA
AGCTCGACGTGTCTTCGAGACGAACGCAACTTCTTCTGTGCAGATTGGGGAAACTGGAGCAGATGACGATGTCGTGCAGCTGCTACACCTTCAGAAGACT
TATCCAAACGGCAAGAAAGCCCTCTGTGATCTCTCGTTTGGCTTGAAGCGTGGTGAATGCTTTGG