Description :
From Genome Similarity Track
Location :
Scaffold_2264:1203- 3352
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2264-fgenesh-gene-0.0Conserved hypothetical secreted protein

Sequence
2149 bases(100 bases per row)
ACGGACTCATGGTCTCGGAGCGGCTCGGCGCCAAGAGCTTTGCCGATGTCTACTACAAGCTCTACACGGACGATCTCCCCGTCTATGTCACGAGCGACTN
NNNNNNNNNATGGCACTTTAGCTTTGACACGTTCCTTATGGACCTCGAGATGGACGAGCTCATGCCACTGCTTGGAGCGACGCTCAGCAAGACGCTCGCG
GCGTGTCATACCCAGTATGATGCAGCGCTGGCTGCCGGCCACGACGCCGCACTGGCACCTCTCGCCGAGGTCGAGCTGTTCTTCGCCGTGGCGCATCGCC
TGCTGCTCAAGGCCGACGGAGCTAGTGCTACGGAGGAGCCGCCCGCCGACGAAGACGACGAACCGTTCTTTGGTGAGTATCAGCGCCGCCGTGAGCAAGA
GGCTGACGCTTTGCACGAGGCATCACTGGGCGAACGTCTGCCACTGCGTGCCACGGCCAACGAGAACCGTCTCACGGCACTGCTGGATGCCGTGGCTCGC
AAGCAGCTCACGAGGACAACCGTCTTGGGGTCCGAACGCGACGTCGACTTTTCGCTCTTTACGCCACGCGGCCACTACGTCAAGACGGAAAAACTCAGGC
GCTTCTTCCTCGCCATGACCTGGCTTGGCACGGTCGACTTTCGCGTGGACGGCGGAGCCAACGACGAAGAGAACCTCTTTCAGCTGCAGTGCGCCTGCCT
CGCAGTGCACGTGCTGCGCGAGGCCAAGGTTCTGCAGGCGGTCGAGACCATCCACGAGACGATCGCGTCGCTTGCGGGCGATGGCGTCGGCGCTGACAGC
ATGACGCTGCGGCAGCTCCACGAGCTTTTGGGGAAAGACACGAACCTGCTTGCAACCTGTGTCGGCCCTAACGCAGACACGTATCTTCGCAGCCTCCAAG
ACGAGATCGCCAACCGCGGGCTCGGCGCGCAGGCCATTGCGGGCCACGTGCTGATCGCGCCATTGACGGGCCAGCCGTCGCGGCCACCAACGGCGTTTGC
GTTTCTCGGGCAACAGTTTGTGTGGAGCGCGTTTGTGTTTTCCAAGCTCGTGTTTGACCAAGTTATCTCGGACGACGGGACCAAAGTGGTGCGCCGTGTG
CCCAGCGGTGTGGACGCGGCTTTTGCGCTCCTTGGGAACGACGCCGCGAGCAGCGTGCTTGCCCAGCGCATGGCGGCGTCAGCCGAGACGAGTGACTTTG
TCAGGTTCCGGGACGGTCTCCCCTATACGCCCAGTCTCATTGCGACCCGCCGACTCGTCGACGACAAGCTCCGCCAGGCGGATGCGTCGACCAGCAGCGT
GGCACTGCTGTGGCAGCTTGCTCTCCGGGAACTGTCGGCGCCCAGCGCCAATGCTGCGCCCGTCTTCCAGTCCGACGTGTGGCAGAAGCGGCAGATGAAC
ACGCAGCTCGCATCCCTCACGCAGCTGCGCCACGACACGATCCTCTACGCCAAGCAGGGCGCAACGTTCAGCACGTGCTGCGAGTACCCGGCCGGGTACG
TGGATCCGTACCCGTCGTTCTGGCGGGCCATGCACACGCTCGCGACGCGCACGCTTGCCATTGTCGAGACGGTGCAGCGTGCCACTGCCCAAGTACGTGG
CCCCACGAACCGAGACCGAGAGACCAAGATCCAGTGGATGGCACGGCCATGGCTTACTAGCGTCATCCACGTCACGCAAATGCTGCTTGACATCTCGACG
GCGCAGTCCAAGCAGCAAGAGCTCAGTGCCGAACAGGTCGAGTTTCTCAAGTGCGTCATGGAAGAGAGCCACGGGAGCGGCGCCTCGCGGTTCCTCGGGT
GGTACCCGAGTCTATTCTACACCAAGCGTGAGGACTCGGCCAAGCGCGATGTGCTCGTGGCCGACGTGCACACGGACACACCATCCGTCGAGCACGGCGA
CGAAGGCGGCGTGCTCCACATGGGAGTGGGTGACGTAAACCTCGCCATGGNNNNNNNNNNAGCACGGCGACGACGGCGGCGTGCTCCACATGGGTGTCGG
TGACGTAAACCTCGCCATGGTCGTCGTGGACGACGCGCTGTATGCAGGACCAGTGTTTAGCCACTATGAGCTGATCACGCCCATCAACGAGCGGCTCACG
GATGCCGAGTTCAGCAAGCGACTGCCGTCGCTGCGGGCCCCGCAGTGGG