Description :
From Genome Similarity Track
Location :
Scaffold_357:1202509- 1203968
Transcript NameFunction/comments
Aphin_H310_02058Hypothetical protein

Sequence
1459 bases(100 bases per row)
GATGATGGTGGCATCGGGGACAGCCATCCCAAAACTTGGGCTGCGACGGCAGTGAACGCGAACCGTACTGCAAATGCACTGGCTTGGACTCGACCTCGTT
GGATAAACGATTGGTAGTGTGCAAGTTGAACAGCCCACACCTCGCAAGTCATGGTCACTGCAGTTGTCCCGACAAATGCCACGATCGTTGCAACGACGGC
AATTCCATTTGCCCAGTGCCATTCGTCCACACCAAATAGTACCACACACGCTGCTCCATAAGCTAACCATCCCATCGCAAGAAAGAACCAACAGCAACGA
AAGGTGTCGGAGAGGCCACCCACGAGAAGACTGCATGGCCATGACACAATAGAGATAAAAGGCGACAACATTGGTGTTCGAAGACGCACCAGGAAGTTTA
ACGCGCCTAGGACAAACCCACTGGCAGCAAACTGTACCAAAAGCACCGCCACGCGCCGAGTTCCGCCGGCGCATTGCTACCGTCCAGAGTAGAACGGTCA
CGGTCTTCGATCGACCGACACGTGAGGAAGAAGTTTTCGTGGAGGGTGCTCAGCACGTTGGCGCAGTCCGCACCTTCTGATTGGCACGACAGGGACGGCA
CTGCCAGAACACGCAAGGCTCCCAGAGTGGAAACCACATCATCTTCGCCAGTAAATCCAAGTTGATGCGTGTCAGGCAATCCACGGTTCCGGCCCGGCCT
GAATTGTTGTCGCGGGTGGAGCAATGTAGCCGATGGCACACGTCGAAATGTTGTATTGAATTGCTGTGTGCACTTGACAGGACACAGGGGAGTCCATGAC
GAGGGTGGACACTCACAGGCAGTAGCACCTCATGCAACAGGTCAGAGTGTTGCTGCAGTGAGGCACATGCCGCAATGCGTCGCCAGGTTCACCAACCCAA
GGCGATGGTGCCCGCTGCCGTGACAACGTCCAAAGGTGCAAGTACAAAGTGCACTGCATTGCCGTGTGAAGGTTCATACGGAGCGCCGCCGACAGTTTTG
GTGGTTGCAATTCATGACACTTCCCGTCATGGCTCGTGGATCGATACATTTTATTCAAAACCGAACGTCCTCTCGAGTCATCCACAGCCATTCGTACACG
AGGAGGACGTTGATGTCGCAGAGGTGCATGGCCAGTGCCTCAACCGCTTGGTCCCACACGAACGACACGTTCCAGTCGTGGGCAGTCATGGCAATGCCTT
CCAAGACCAGCGTCGCGTTGGCGTCGTGGCGCTGCATGCACAGTCGTTCCGCCATGGACAAGATCGTAGCGGGCCTCAGCTGCCATGTAATCGTATCCCG
TGCGACTTGACGTCCGACGTATTGCAAGCGGCACCACCGAACGTGGTGGTGCTCATGGATGTTGGTAGTAGTTGTGGCATCTCGACCACCTGTGACTGAA
AGAAACACAATGGGGGGCGTGGGATGCTTAAGGGACTGACGGTTGTTCGACGCCAGGCG