Description :
From Genome Similarity Track
Location :
Scaffold_496:12025- 21653
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_496-fgenesh-gene-0.2DEAD/DEAH box RNA helicase
Pytve_DAOMBR484maker-pve_contig_496-fgenesh-gene-0.5Amino Acid-Polyamine-Organocation (APC) Family

Sequence
9628 bases(100 bases per row)
AGCTGCTCGGTTCCAATTTTGGTGCCTTCGAACGTTGGGAACTCGTGGGATTGCTTCGTGGGCGTGGAGCCGGTTGGGATATCGACCTGGCTCGACAAAA
ACCACACACACAATCGCGTTAGCCTGCGTTTTGACAAGATCAAACATGGCATGGTATGCACCTACCCTTCGCTTCTTCATGTACACCTCCAGCTCTTCTA
GTCGCTCGGACCCGTCAGTCAAACTTTCGTCAATCACCCTCTGCGATTGGACAGATACCGCATCCAGCTTGCGCTTCGCGCTTGCCACGTTTTGCTGGAG
ACTATCACCGATAGCGGCACAATCCCTCGCCACTCCGCGTCCAATTTCGGTGTGACAGGCGACAAAACCGTTAAAGCTCTCGATTCTGTCGCTGCGAAGC
AACTCGTCTTGTTGCGATTGACGCGAAGCCAGTTCCGCCACGACGGCGCTGTGCGACTTCTCGAGCTCACTCACGTCCGCACTCCATTCCGTCATCTGAC
TCACCTGAGTCGTGATCAGCGCACTTTGGCGTGCGTGGCTGGCATCCTCGTCACGCTTTCTCTCCGCAATCTGTTGTTGCAGGTGGTCACTGTCAAGCCG
ATTCTTCTCGTTGCGAGCACTCAACAACTGAACCGAAGCTCGAATTTCATGTTCGGTGGACTTGTGAAGATGCAATAGGTGCTTCTGCTGAGTCCGCTTG
TGCAAATCAAGGAGAGCGGTTTGTTCATTGAGCTTTTCTGTCTGGGTCTTGGCGCAAGTGTCGACAAACTGCGATAGCTGGAGCTTGAGCCGATCGAATT
CCACTTGCTGTTTGTCGTGACTGTCCTTCAACGCTGCAGCGAGCTCTGCATTCTTGCTGACAAGCTGGTTGGTTTGTTCATCGATGGACATGTCGATCGA
CGCCTGAAGCTCTAACAACTTGTCACTCTGCTCGTTGAAGAAACGTTCAAGTTCGCTCCTCGATGTTGTCGTCAGTTTCTGGAGGTCGTCAAGGAACTCT
GCCTGTCGTGCTTGGGATTTTGTCAGCTCCTTGGCAGCAGCGGCGGCATGATCTCTGCCAAGCTGCACGACGGTCGACAGACGGAGTCGCATGTCTTCCT
GCCATTTGCTTTCTGAGTCTGCCACCTCCGATGCGCACTTGTCTCGCACCTCCTTCTCCTTACTCTCCTGGACATCCATCTCAGCCTTCCACTCGTCCAA
GAGCTTCACGAGAGCATTCACGTTCTTGTCCACATTCTTCAGATCCCGCGAATGACTGGATTCCAACTCGTTCACAACCTTGACGATGTCGCTGAACATG
CCGTCTTGCTCGATGCGATGCTCAGACAAGCGCGCTTGAAAGTTAGCGACACGCGATTTGGACTCATCCGAAAACGCGTCTGCCAGTTCGCCATTGGTAT
TCTCGACCGTTTGCTTGCGACCTGTTGACAAACACCGAGTGTAGGGGTTAATGACAATGCACCGAGGTGACATCAAACATGAGGAAGGATGGATGCGCAC
TCACCGATTTTACCAAACAGTTGGACCGAACGCTCTTCACTTTCGCGAAACAACTTGGCCGCAGTAGCTCCTCTTTCCAGCAGAACCTTCTCGTTCGCCT
CAAAAGCCCGCAGCTTCTTCTCTGAAATGGCAAGTTTGGCCGAGGTGTTTTCCAGCTCCTTTGTCGTCGCGCTGAGAGCACTTTCTGTCCGTGCCAGCTT
GCCTTCCAACTCCTTCTTTTCACCCTGAAGAACTAGCTTCTCTTCCGTCTGATGCTTGACAGTTTCTTCGAGCTCTTTGCAAGCCTTATTCCGCGCTTCC
AACCCATCTTCTAGTTCCGAAATCTGGATCGACTGACTGGAGATGCGCTCCTCCATCTCAGCAAACTGCGCCGGTGGTAAGAAGATGCCTTCCTTCTGTC
GCGCAAACTGGAGCGCAGTACGCAACGACTCGATCTCATTGCCGTACTCCTTGAGCAAGCCAGTACGAGCCATCTTCTGGTTGACTTGAGGCTTGTTCTT
GATGCTCTTGGCGCGGTACGCGTACTCGAGCGTGCTCAACGTCTCGTCAATGCTGCTTGCGCATGGGGCCAGCGTCGCGATGATGGTCGTCTTGGCTCGA
CCACCTAGCGACTCTTGCAGCAGCCGCGTGAGCTTGCTGTCTCGGTACGGAATGTGTGGGTGGTTGTCCACCAGCGCCGTGATCACACGTCCCAATGTCA
GCAAACTCTGGTTGATACTGCCAGCTTCTCGCGCGCGAACGTTGCGAGCGCCAGAGCGACCAATACACTCCGAACCTGCGAGATCAACCAGGTTAAGTTG
TCCGATGCGCAGGAGGTCGTCGCCCGCCGCCTCGGCGGTCGTGTCCTTGCAGTGGATGCGGATCGTGAAAATGCTGTGCGAGCGGCTCGAGTTCTCGTTC
ATGAGTGTCTCTGACGTGATGCGGTTCTTGACGCCCGTCTCCAGCAGCTCAAACACGTGCTCCGCAGTGGGTGTCGTCACTTCGAGCAGGTTCTGACAGT
AGATACCGCCACGCTTGACGTCTTCCATCAGCCGCAGCTTCTTGTTCTCGTTCGGAGCGAGCAGGTCCTTGAGCTCTTCGTTGTAGATCTGCAGGAAGGA
GATCTTGATGCTGTACTCCTGCTGCATAGTCTGCAGCGTGTCAAAGATGTAGCGCACGCTGCGCGGAATAATGCCAGCGAGCTCGTCGTCCGGCGACAGG
TCACCCTGCATGGTGTATGTCTTGCCCGTGCCGGTCTGGCCGTACGCGAACACCGTGCAGTTGTAACCCTCGAGCGCCTCGTCCACCACAGGTTTGATCG
TTGTGCGGAACACGTCCTTCTGCGTCGAGTACTGGCCGTACACCTTGTCGAACGCGTACGTCTTGCGCTTGAGCACCGTCACCTCGTTCGAGTTGGGCAT
GCACTGCACCACGGCGCCGCGGTTCGCAGCCTTCTCGCGGTCCGTGAGCGGCCGGCACCGCACGGCCACCTGCACGTTCGAGTCCTGAGGAGGGGGCGGC
GCCATCGGAGAGCTGGTCGCGGAACCACCGCTCTTGCCGTGAGGTGAGTGCCGCAGTGGCGTCGTAAAATGGCTCATACTAGTCGCCCGCTGGCCGGAGA
ACCGCGAAGCGAGGGTCCTCAGCCAGGGGAAGCGAGCAGGCTAGGACTCTTGGCGGCTCAGAGCGCGGGGGCACCAGAAGCTCGTTGTTCCGACGCGGCT
ACGGAGAGACCGACCCTGTTGCTGCTTTTGGCGCGCTGCCTTTCCTTGGAGAAAGCGCGCGCGATTTTCGAGGCTTCAAGTTTCAAATTTCGCACATTTG
CCCCGTTGATGTCCAGCATTGGTTCAGTGGACGCAAGAGTGGACAGTGTGCAACCGTCCACCAATCAGCGTCGACTCTCGAATATATCGTCCGCCACATA
CCGATCGTACCAGTAGTATACCGAAGACCTCGGTATGTTTGATCAGCTTCGCCAACCAACCGGCGTGGCCGCTTTGACTGGAAGCGGCAGCTCTGCATTC
GCTACGCGAAGCCTCTCCGTGCCTATCGACCGCGTGATCCTGTGTTCAGAGTGAGCAGCCATGGCGGACGCGCAGCACGTGAGCGAGAACATGCTGGACG
CCAAGCAGCCGTTCGCGTCGTGCGACTTCGGGCTGGATCGGCGGCTCGCGAAGGCGGCGGCCAAGATGCAGTTCGTGTACGCGACGCTCGTGCAGGTGCA
CTGCATCCCGCTAGCCATGCAGGGCAAGGACCTGCTGGTGCGCGCGCGCACGGGATCGGGAAAGACGGCGGCGTTCGCGCTGCCGCTGCTGCACAAGGTG
CTGCAGCTGAAGGAGACGAGCAGCGATCCGTCGGTCAAGGCGCTCGTGCTCGTGCCGACCAAGGAGCTCGTGGAGCAGACGCGCAAGCACATGAACGAGC
TGATGTACTACTGCCGGGATGTGGTGACGATGCTGGCGCTCGGCGGTCAGAGCATGAGCGCGCAGCAGGCGCTGCTGCGTGACGTGCCCGACGTGGTGAT
CGCGACTCCCGGTCGTCTGGTCGCCCACCTCGAAGCTGGCAATGTGCAGCTCAAGGACTCGGTGCAGACGGTCGTGATCGACGAAGCGGACCTGGTGCTC
TCCTTCGGGTACGGCGAGGATATCCGCTCCATCTTTAACCAGCTGCCCAAGGCGTGTCAGACGTTCTGCATGTCGGCGACGCTCAGCCCGGAGCTCGAGA
AGCTCAAGAAGTCGGTGCTGCACAACCCCGCGGTCGTCAAGCTCGAAGAAGGCGAGACGGACGGCAAGCTGCAGCAGTATTACCTCCCTGTGGTCCACGC
CGACAAGGATCTGCTGCTCTACGCGCTGCTCAAGCTCGGCATCGTGCACGGCAAGGTCATCTTCTTCGTCAACACGACGGACGCGGCGTACCGGCTCAAG
CTCTTTTTCGAGCAGTTCCTCATCAAGAGCGCCGTGCTGAACGCGCAGTTGCCGCACAACTCGCGCCAGCACATCATCGAGGAGTTCAACCGCGGGCTGT
TTGATTATTTAATCGCCACCGACGACAGTGTCGACCGCGCGTCCGATGACAGCGACGACGAGGTTGATGATGATGAGGAGGAGGAGGAAGAAGAAGCTGA
TGACGACGAGGAGCAGGACGAAGACGCGGTGGAAGAAGAGGAAGAAAATGACGCGAGCGACAACGAGGAAGACGCTGATGCCGAGTCTGACGGTCCAGAG
GAAGAGGAGGAGGACGACGACGACGACGATGCGATGGACGGAAACAGCGATCATGACGACGCTGAGGACAGCGACTCGGAGCCCGCTGCCGACAGCAAGT
CGAGCGCCAAGAAGGGCGTGAAGCGTGCGCGTGACGAGAGTTACGGCGTTTCGCGCGGCGTCGACTTCCGTGGCGTCAACTTCGTCATCAACGTCGACTT
CCCCAAGAGCGTGCGCGCGTACACGCACCGAATTGGTCGGACGGCTCGTGGTGGTGCGAGCGGCACGGCGCTATCGCTGGTGACGCTCACGGACGACAAG
CAGAAGCGCGCGCTGGACCGTGTGCAGGCAAACCAGAAGGCGGTGCTCACGGCATCGAACGATCTGCTCAAGCAGCCGGCAGAGCTCTCGTTCGACATGA
AGGAGATCGACTGTTTCCGCTACCGTGTCGAGGACGTTCGACGCGCGGTGACCCGTGTCGCCGTTCGTGAGGCTCAGCTCGCGGACGTCAAGAAGGAGAT
CCTCAACTCGGACAAGCTCACGTCGCACTTCGAGGCGAACCCGCGCGACCTGAACATCCTTGAGCACGACAAGGCCATCGGCTCGGCGCGCGTGCAGCCT
CATCTGGGGACGATCCCTGACTACCTCGTGCCTATTGCGCTGCAGGCGGCACAGCCCCAGAAGAAGACGGGCAAGAAGAACAAGCGCATGCGTCTTGCAA
ACAACGCGAGCGGCAAGCGGCGAACAGACAACGACCCGCTGCACACGTTCTCGGCTGGGGCTCTCGGCGAGGACGGCGAGGACGCTGGCGGCAATGCGAA
GCCCGAGTCGACCGAGGACCGGATCACGTACGGCAACACTGGCGTCGGTAAGAGCACGGCCGGCCGCCAGGCGTGGAAGAAGTCGCACCGCAAGGGCCGC
TTCAACCCCAAGACGATCGCCAAGAAGAAGTTCAAGATGAGCAAGGGCTTCGGCCACTAAAGCGTGCTCTTCTCCGGTGCCAGCCACCCGGAAGCTCGAT
CAATAGATTCTTACCTATTTGTTGATGTTCACATCGTTCTTTCGGTTGGCATTGCCGGCCTCAGCAATCGCGAACAGTACTGGATGCGAAAGGTGGCAAC
ACCACTGGGCGACTCGTGCCGAAGTACCGCAACGCTGCGGGCGGCGAGTTCGTCGGTGGCATGAACGTAGCAAAGTCGCCTCCCGAAGCAGCCTCTTGCT
GCAGCAGCTCGTTCCACAGTTCGTCCTTGGCGAACTGCAACGCTTGTTCTTCTGGCAGATCGTCGATCTCAACCTGCACCAACGTGGCATCGGCTCGGGG
CTTGAGAGCTTCGAGAACGGCGCGCTTCTTATCGTAGACGTAGTCGAGCAGCTGCAGACTGCGCATGTGTTCGAGGTGCTCCTTCTCAATGAACTGGAGC
TTCTTCTTGTCGGACACGGTCTTGGCCGTGGCTTTAGCTGCGAGAATCTCTGGTGGTTGCTGGAACACGGTGCTCGTGGACGCCGACAACGCGAACGGCG
GCTTGTTGTTGCGGAGCATCTCCTGCCGCATGTCCAAGAGCTCGCGCGTGAGCTGGAGCTCCTCTTTGGTGATCGCCTTCATGGCCGACACTTGTTGCAT
TTGCTGGCGCGTCTTGTCCTCCGCGAGCGCTTGGCAATGTGTCTTGTGGAGACGGTTTAGCAGCTTTCGGTCGTCAACTCGTGCAACCTGGCGATCCAGA
CTCGCGTCGCGAATGTCACGGAGCTCCTCGTTCTGCACGTGCCGCGATATCATCGCCACACTCGCGGAGAAAGCGCGAGCCATCTCGGTGTTCTCAAGTC
GTTTCTGTTTGGCACGAAGCTGCTTCTGTCGCTGCTGTCGCTGTCGGTCGCGAACTTCGCTGATGAGCGCTGGAGCTGAAGCACTTGACGTAAGATTTGG
TCGAGGCGGCTCCTACATTTACAGCAATCGAGTGTTTGGTCAGCATATCCAGCTATGACGTCGAAGATATCAGTCAAACGTACGGGCGGAGGGTTCCGCG
CATAGTCGTGGTAGGAGAAAGCGGCTGCGGCGTCATTACCCTCGGCCATCAGGTTGAACGGATGACGAGCACGCTGGTGTAAGGACTCTGGTGCTGGCGA
GCAGGAGTTTGAGTCGATTGTCCGAATTCGCGTAAGTCGAGGCTTCATGTGCTCAATCATGAAATCCTCAGTGAACCACAGTCGACAGGCCTGAACGAAC
GCAGTCGCAGGAATCGTCACGGCAGCAGCGGGCAGTGACTGTTCCCATTGTCGGTACATGGTGTCGCTGACTGGCAATTCGAACACATCGAGCAGCTCCT
TCACTCGAGACAGCTTGATGCACTTTTGATGAACGATTGCAGAATCGAAAGTCAGCAGCATCTGCTCGCAGGTTGCAAGGAACTCGAGCTGCTTCCGTGC
CCATTTGCCGTCTCCTTGAGCTTGGAAGGCGGATCGTGACTCTGGATTTGCTGTCTCGCTGTCATCTGTGAGGGTCGCTCGACTTGCCGCCTGGTTTCGA
GCGAGCATTCGGTTTGCCAGATCCGAGCTGCCGGCCATTTTCCGCAGCGTCTTGATCGCCGCCGTCGATTGCGGCTGCACGAGCGGAACTGCTTGCCGAT
ACAAACCGAGCGACTCTAGTATATCGTTTGCACCATCACAGCTGCTGGTCGCGCTGGTGTTGCCATCATTATAGCTGCCGATTTGCCCAGTCGTCTTGCT
GTGACGGAGCACTTGAATGCTCTCGCGTTGCAGCTGGTCATTTGAGCAAAGTTCCATACCCTCCGCCGCACCATGCGGATGGCTTTGTTGCTATTGTGGC
GCTCGCACCATCGCCAGGCGCTGAAAATAGCCGCGTTTTAGCCACACAACACCAGAATGACGCGGGAACGCGAATTCACAGTGAGCAAAAATCTCAGTTC
TATTGTGCCCTGATTCACTCTAGCAGATCGCACAACTTTGTACACATTCTCTCCACCTACAGAAGCGGAGCCAGCAAGTCGGCATCGTTCAGGACGCTGT
GGCGAATGCCATACAGCAGATACACAGACAAGCCGCAGAGCAGCCAGATTCCGACTCCGATCCTGAATCAATCAGCCCATGTCGTTAGTCGGTGGCTGCT
ACCCCCTCGCATACAAAACTGCACCATTCACGCACCATCCAGCGCCAGGAATGCTAGCCATCATGTAAATGTTGGAAATGATGCCGAGGCACGGCACGAG
CGGCACCAGTGGACACTGGAATGAGCTGGTAAGCGGGCTAAAGGCACACAGTCAGGAAGTCATAGTTAGATGCTAGTTTCAGCGTGGCCGACGAGTTCGG
CAAACATACCTGAGCTTTCCAAGCCGATGAATAACAACGAACGCGGCGATGGTGACGATGATCAGCGCCGATTGGATTCCCCAATGCAAGTCGAAGACGA
GCGACAACGACAGCACGAGGCACGCAGCGACAAACACGAGAACGCGATGAACCACTCCGGCGCCACTGAGCGGAGGCTTCATCCGCAGCAACAGCACGCC
GGCGTTGACGAACGTGAAGACCATAAGCGTCCCGCACGAGATGACGTTGGCGAGGAAGTCGAGGTCGAAGATAAACGAGACTAACCCCACTAGGATTCCA
GTGAAGATGGTGCTCGCCACTGGCACGTGGGTCTTCTTGCTGAGCCGTCCAAACAACTCGGGAAGCAGACCATCCTTGGCCATTTGGTAGAAGATGCGCG
GCTGTCCCATCAGACAGGTGAATGCCGCGGTCGTGAGACCAAAGATGGAGCCGAAAGAGACGATTCGTCCGGCCCACGGAACGTGGTGGTAGATGAACGC
GTTGACGAGCGGCACATCTCCACCCAGCACACTGACAGGCGCCATGCCGGTGACGACCAGCGACACACCGACGTAGATCATCATTGAAATAATCAGCGAT
CCGATGATACCCTTGGGCAACGTGCGCTGCGGCTCGTGGACCTCCTCGGCAAGGCAGGCGACCATGTCAAAGCCCAGATATGCGAAAAAGACGACGCCAG
CTCCAGTCATGACGCCGTGGAAGCCAGCGGGCATAAACGGCTCCCAGTTCTCCACATCGACATGCGTGCCGCCGTACGAAATGACGAACACCAAAACGGT
AATGTTGAGCAGCGTAATGAACGCGTTGAACTTGGCCGATTCCTGTCACAATTACATCAACACACCATCCGGCGTCAGTCCACGCTCGAGCCGACTGCAT
CGCTCTGCCTTCAGAGACAGCTCGAATCGACAGATAGCTTACATGGACGCCAGCCAGCAGAATGAAGGTGCATGCGATCACGAGGAGCGCCGCCAACAGA
CTGCAGGACACGCCGAGCACCTCCGTCCGCACCAACCAGTGCGGAATGTCCAGTCCGAGCTGCTGAAGAAACTGCTCGGCATACGCGGCCCAACTCCGAG
CAATGCCGGCTGCGAAATGGACAGCAGTCAGCCAAGTTGAACTTCAAGGCTTTGAAGTATGCAAAGTCAAGTCGGCATTACCGGCAGAGATGCCATAGCC
GAGCGTCAGGTTCCACCCGATCAACCACGCCGCTAGCTCGCCGAACGTGAGGTACACGAACGTGTACGCCGATCCCGTGACCTGCGTCACAATACCAACC
ACCAAGTCAGAGGTCGCATCGAAACATAGCGGCAGGTGCGCATCTGCAGAAATGAAGCGGTAAAAGCGTCGCGGATCGAAACGCAGCAACATACCGGCAC
GCGAGCCGCAAACTCCGAGTAGGTAAGCGAAGTGAAGATGCACGCGACGCCGCTGATGAGGAACGAGAGCGAGATGCCCGGACCGGCGAGCTGCGCGCCG
ACGCCCACGAGCGAGTAGACGCCGGCGCCGACTGAGCACCCGACGCCGTAGGCGATCAAGTCCGTCAGCGTGAGGCACTTCTTGAGCGAGGTCTTGCCCA
GCTGCAGCTGGTCCAGCGGCTTGACCCG