Description :
From Genome Similarity Track
Location :
Scaffold_4:12025- 17468
Transcript NameFunction/comments
g3531.t1hypothetical protein
g3532.t1hypothetical protein
g3533.t1hypothetical protein

Sequence
5443 bases(100 bases per row)
TTCGGTACTTCATTCAACACAGTGCTTCAAGTGGCGGGGATGGCGGCGCGGCGACGACCACGGCGGGACGGCAGCAAGCAGTCAGTGTCGCGCGTGGACC
TGGCAATGATGATGGCGGGCGCGGTGGGACCGGCGACGATGGCGGTGATCGTGGACCTGGTGACAATGGTGGCGTCGCGGGGTCTTCCGCATGGCAGCAA
GCCATTATTCACGCGCGTGGGCCTGGCAACGATGGTGGTGTCGCGGCATCAACCGGATGGCAGCAAGCAGTTGTTGACACGCAACGGCCTTGCGACGATG
GTGGTGGCGTTGTGGCTGCGGGACCTGTCGGTAGTGCCCGCAGTAGTGTTCGAGTTCGTGGGTGTGGGCGTCGGCGCGGTAGTGGTCTTGGCCGCGGACG
CGGAAGCGGTCGCGGAGATCGAAGTGTCAGGAGCGTGATGGAAGAGGCGGCTACCGCAGCTACCGGGGCGGAGACTCCAAGACGGCAAGCGAGCTTGGTG
ATTGAACCCAACCTAGAAACCCCAACGAGTGTCCCCACGCGCAGTACGACGCAGAGACGTACTCCTCCTGCCCCTTTGATGGAGCATCTATTCCTAAAGA
AGCTGGTGGCATTTTCACCGTCAAAAGAATTGTGGATGAAGGAAAAGGTGTATAGATGCGTGGGCAGAGCCTTTATTGTCGGTCGTGTGTGTCGTCAGGT
CAAAACGACGAAGAAGGGAGGGGTACTACAAGTGATTTGGCTAGATACGCAGTTCCAGAATGCAGTTGAAACTCTGACTGTGGCAGTAATTCAGCGCGGG
ATTGAGAACTACCAGGCTCTCGCGCGCTCACCCAACAAGCCGGCGTGGCGTGAATTGACTGATACAGTGGTGGAAGGGGAACTGCAGATGGAGGAACCGC
TCGATGAACTTGAAGTCGCGTCAGACGACGACGGTATGGAATGTACGATCCAGAGCGATATTTGCCCGTGAGCCTTGCGGAGGTGGAAGCGGTGAAAAGT
ATGCGGTTTCAGCCAGATGTGGAAATAGATGGCCCCACGGATCTGTATGAACACACGGACGAGAGCACTAGTACACGCTTACTACCCGAGTACCGTCACC
TGTTTGCACACTCAGCCTCTTCGAGCTTCTTCGCTTACATTCCAATTTACTTCTGGAAACAAGTGGTTCTCGAGTCGAATCGATATGCAGCCCTCAAGAA
TGTTCGAATCACCACGCCGTTTACAATGGAAGAGCTGATGATCTTCCTCGGCATCATGCTTTATCTGACCCTCACTGACAAGGGGGAGTACTCTAACTAC
TGGGGGCCACAGACTGAAGATGCGGTTTTTGGTGGTGCATCTACCAGCTTGGACAATGTGATGAGTCTAAATAGATTCAAGTTGCTTCGCCGCTGTTTGA
GCTTTCGTGCTGATCCGGGATCGGCTGTGGAACGAGACCCAGCAGCCCGAATTAGGCCCCTATTGAATTTGCTCAAATGCACTGGTGGTCGCTATGTTGA
GCCTGGCCGTGACTTGGCTCTTGACGAAGCCAGTATCGCATGCCGGTCCCGCCATGGACGACATCTTATCGTGTTCAATCCCCAAAAGCCTGGCGGCAAG
TATCATTTTCGTATGTACGTGCTGTGCTGCTCGACCACGTGGATCGCTTTGAACTATCGCCTCCACTGCAATAATAGTGATATCGCGGACCGCCTGCAAA
ACGTGGTGAGCCCAGAAGAGGTGCAGCAGCTTCGTGAGGAGCTCGAGGATGTCAAACAAGTGCGTAAGCATGTTCTAGAGGTCGTGAGGCCCTATTTTTA
CTCTCGACGAATCATCAATATGGACAACTATTACACAAGCGTCCAGTTGCTGTTGGATTTGCGTTTGAAGGGGTTGTATGGGCGGGGAACTGTTCGGGGA
AGGAGTAAGCACTATCCGAAGCACACTATTCTCCAGAAGGAGCACTCAACAAGGGGTGACTATCAGCAGTCTGTCTCCCTGGAGCACAACTTGCTCGCTG
CGTCGTGGTGCGATGGCAATACCGTGATGATGGTTACCAATGCTGATGCATCTACTGCCGCGACGGTCACGCGGCGGGTTGGTAAAAATACTCATGAGTT
TCCTGCTCCGAGCTGTATCCTGCAATACAATCGACACATGCAAGGTGTTGATCGTTTGGATCAGATACGAGCTAGATTTTCACTAGCTGACGGCCATTCG
TTCAAAAAATGGCATAAAAAATTGGCTTTGGCAATAGTGGATATTGCACGGTCCAACGCGTACCTGATTCGACGGATGGCAATCGACACTTCCAGAGATC
GAGATCCCCACAGGACGTTTGTCACTGAATTAGTATCTGAGCTAATTTCTGGCAGGTGGCAAGAAGCCCCGAGCGATGGTCAACTGGCGTTTGGAAGCGG
TGTTGCTGATGAAACCGCAGCAGTGGATGCAACTGGTATAACTCCAAAAGTGTACACTTCGCCAAACCCGCACAGCGCCCTGAAGCGATGTCAGTCTATG
TCTTCGAAACAAATGTTCAAGGACAGTGGGCGGAAACGTCGACAGTGCATTGTGTGTCGCTACGAGGGCAGATATCCTACAGAGGTGACGGATTATTGCC
TCACGCACACTGTTTGTCTTTGTAGCACACATCGAGAGTCCGTACACGTGCCCACAGAGCACTTGGACTTGTTGGGATAAGTTTCACAGATTCTATCTCC
CTAATGGCCTCTTCAGTGACAATGGAAATGTCAACAGGTCATCGCATCTGGCTAAGTTGAAGGCAAGTAGCGCCGCGAGACCCGTCGGTAAAGCTCTCCC
TATCCCCGACAGCGACAATTCTGTACTCTCCGTCGACGAAGCCGACCTACTTCTCAGTAGTGATTGTGCAGAGTTGCTCAGTGAAGATTCAGCGAGTCAA
GACAGCAGAGTTGCGCGACAGATATTCCAATGATTCGCATTCTGTAGGCAAAGAAGAGGGTATTTATCTTGATTAAAGTATGATAATGCCTTCAGAGCAA
CATGACCGAATATATATCGAATAAACTATGGTCAATGTCTTTAGCATTATCAACAAGTGTTTCTCGTTCCAAATAACACAGTGGCAGCGTTGCACCCACG
GCCATCGCGTTGTGCGCCAAGGACTTGGCGCACAACAGCTGCAGCTTGGGATGGACTGGGCGGCCGCAGTCTCAGCGCGAATGGACTTGGCGAAGGAGGG
AACGACGGACACAACGCGGCTGGCGGCGGCTGTCAAGACCGTGGTGATGCCCAGAACGGCGCAGTTGGCCTACCACAGGAACGTCGCGGGCACTGGGCTG
CAGTTGGAGCTGACGCTGGCGATGATGGCCGAACAGATCCAAACTTTCACCAGTCAAATCTGTCATTATGATTGGTCGAAATATTAGTATGGGAGTTTGT
ATACAATCGTAGGAAAAATCTCCGACGTTTTTCCAGTTATACAAAATAGTGAGGGGCAGAGTGACCTAACTTTTGTATGCTGGTTGTGTGAAGGCTAACA
GTGGTTGTATTGTAGCCCAAAAATCCTATACGAAAACAACTTCCTGGGATTGGTCACAGTGTGGATCCATCCAACGGGCGCAACACAACGCCATTGTCAC
GCTCTCAGCCTCTCCAGGGCGAACATCAATGTGCGGAGCGCATACTGCTCGCAATAAAGACGGCTCCAGTGGTGCCAAAGCACAGTGGGCCGGCCCTCAC
GGTGTATTGGATGAGGCGAGGCGGGTGAACGCCTTTATCGTCCAGGGTGTATAGCGCACGCGCGCCAGAAGACTCGGCCGATCAGGAAGCTTAAACTTCG
CCTTTCGGAAAGCCCAATGGGGTCAGACTACCTCCAAAAGTACGGGACTTCCGGAAGTAGCTTGGCGTGTGACCTTGTGTAATCCCTATAGGTGTCGTTT
GTCTTCGGAAGACCGGACTCCACCTGATGAGTTGTTCCTACACAATCAAAATGAATACAAGAATACAGAGTGCGTACGTTCACTTCCCGACGCAATTAGT
ACAGCTGGGGTTAGACCACTAGCAAAGCCTTCCCAGATGACCAAATAATACAGAGAGTTATACACAATATACAGCTGCTACTTATTCTTTTGGACCCTTG
AGCAGTGGGTCCGTACACCAGTCTACTTGTGTTTCACCTGGAAGACTGGTCACTTCCAGATGCACCCTTGTTGCGCACCACTTCCAGTAAGGAGGATTTA
TAACTCCTTCCAGAAGATAACTTTCAGATATATCCAAAAGGAAAACCACTTCCGGATCACTCAATATACAGTCCTATCACACAGCAGTCTATTCGATCAA
ATTCCGGGGGGTGACTACTAACAACCTCCTGAAACGGCAATTACTATGAAATGGGGGGTCTAGAGGACACACTCCCAACTGAAATATGAAATAGGACAGA
TCACGTACGAATGCGCGTCACTCGGTCACCGCCTAATTTGGTCTTGAGCCTTTCGGAGAGTTCCACGGCGGTCTTCGCGATCACGACGCGTCCAAACGCA
GGCTGGGTGAACCCGGGTCCCCGGAAATACACGGCGGCTTGTCCGGCGTTATCCCAGCGTGCTTCCAGGCCAACTGATAAGGGCCCTGGAAAACACTTGC
GCCCTTGGTGGCAAAACGAACTCTCTGTTATTTTTAGTCTCTGCTAGAAGTCTTCTGTAAAGGTCTCTGCTGGAAGTCTTCCACATGCACATTTGTCTTG
GTTTCACTATAGGGTTCCTTTGGCGTAATCAGCATCCGGGAGGCTGACACATCCTGGTCGCAAGCCGGCTCTTCGTGCATAACATATCCGGCTGGTCGTC
TTGGTCGGTCGCTAATATCTTGGGCTTTGTATACTGGAAAATTGGAAAGGTCTTGGTGGGTACAAATCAGGGGCGTCTGGTCAGCCTCCGCACCCACAAC
GTCTGGGTCATCTGCGAGTCACATCAGGAAGGAACTTTCGGAAGGCACACGTGACTTCCGGAAGTAACTCGACATTGGGAGGACTTCTGGAAGTCACTTG
GTCTCAGTATGCTGTGGGAACTTGTACCAGTTCTCCGTTCGTCCTCGTTCTTCCCTGTCGCGCGCACTTCTGGACCAATCATCACCGCGAGTGCTTCCAT
GGGAAATGGGAAACGACGCTCGGACATTTTACGTCCAGTCGCCACGTGTCAACCGTCCCTCTCGTCATAAGCTTTCATAGAGGAATTTGCTTTCCCCCCG
AGCTGACAGGTTGTGATGAGATCACACGTGCCCAAATTGACCAGGGTATCCGGTCGGAAATCACATCCGGACGGCGGATTGGTCCTTCAACTGGCGGAGG
TCGCTTCCTTTCTTCGCCCTGTCCCGGATCGTCCAATCACATCACTTCTTGGCGGTCGGAAATCAACGACGTCGAAGCGCGATCAAATCGCAATCTCCCG
CCTGGTGAGCAACAGCATGGCTCCCACTGGCACTTCAGGTCCT