Description :
From Genome Similarity Track
Location :
Scaffold_41:120241- 127854
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14716hypothetical protein
Phypa_INRA-310PPTG_14717hypothetical protein
Phypa_INRA-310PPTG_14718amidophosphoribosyltransferase
Phypa_INRA-310PPTG_14719exportin-2-like protein

Sequence
7613 bases(100 bases per row)
AATGTCCGCAATTACTCCAGTGCCGATGGTGGAATCCTCTGAAGGCTCTACAACCATCAGACGGATACTAAAACTCTCAATTTGCTCATACAACTCGTCA
TTGAGCACTTGCAAGACGATATTCTGCCATCGAATTGTGGCAGAAGCAGGATAATCATCTCGTTTCCACTCCAGCAAATGGGTAGCAGGAGAAACCAGCA
CAAAGTCCGTTGGAAAGCATGCGCTCTTGCACACAACTTCGAATTTCACACTCGCCATGGATGTCGTTCCAGCCACCCAGAGCACGGGAACTGTCAACGT
ATTTCCTTCTGCAACGGTGACCGTAGCAGTCTGGAAAGTGAAGCTGCCAGGCACGACTAAAAAATATAAAGATGAGCGACACTAAAGCGAAGTAATCAAA
GCAAACTTACGATTTGCTGGCGGAACCAGCACAACTTGTGTTTGATTGCGAGCAAGATTTATCTCAGCACCGACAGCGTCGTGCATTTTTAACATGAATG
TCTTCGGGCTTTCTTGTGGCTTGCCGTCATTGTAGACAGGCACGTAGAGTGCTTGCTCGAAATCCTCGCCATCTTGCCACATAAGACTCACGTTGTAAAG
CGGTTTAAAGTCTCGACCTGCCACAGCATTTCCCACTCCCGGAATCGTCGATATATAAACAGCAGCTCTTCCGTCAGATCCTAGACTGCGTTGAATAGTA
ATAGAAGCGACTCCGAAATCTTCGGTCGTAGAGTAGACTGCTTGTGAGAACTGGAAGCGACCACTTGTCGCGATGGCCACAACACCTCGCAGTCTGTCGA
AGATATCGCCAGCTGCGATGATAGTCACAAGCAAGAAGGTCAAGGAGTGCCTCAAGATCGTCATAGAGATGGACTTGTGGTCTACAGGTTTTTGAAATTA
GCAGGGCGAAACCACAACGACGGTTCAAGAGGACTAATTAGCATTCTAGACTACCCGAGGCATGGTATTAGTGCGAGGTGGCTTGTTCTCGAGGTTTTGA
GTAGGTTATTGCACGATGGGTAAGATGTCTGGAGCACAGGAGCAGCAAGATGTCCCTGGAAATGGTTCTCGAGAGGTTTTCCAGGGTTTGTTCAAAGATT
TAGGGAAGCAAGCGATGGCTCTGGAAGCGATTCTGCGGGTGGTGTGCGGTCGGGTGGACAAACTGGAGAATTGGCTTACGGAGGTGAGTTTTGGCATGAC
GGAGCTCGATTTGAAGCTTCGAAATATTGCGCACAATATCGACGGAACTGCTGCAGTGGACGACGAAGCACGAGGACCCCATCGTTGGGCTATCCCTCAA
ACGGAAGCTGTTAAACCCGTAGCATCTACAGTAAGCAAGAAGCTTGGTACAGAGAAGAAAGCGGTTCGTGTGACTGGCATGGCTGCTGCCATTCTTGATC
GACTAGCAACGACTTCAGAAACAGGCACACCTACACCAGTTGAAACCGAGAAAGTTGAGAAGCCAAGTGCAAAAAAGAAAAATAAGGACAAGAAGCATAA
TACCAAGAAAGTAAAGGCAAATGGATCGACGGAGTTACCACCTACTCCATTACCCCCAGTAGTTGAAATCTCGACACCCGTGAAGCATGAACAATACGAG
GTTATACCAAGTACTCCACCGGTACCAATTCCAGCAGTGGTTGTATCGGCTCCTGCTGAAATTGAATCCCCACCGGCAAATTCTGAGATTTCTCGAAGTG
AGTTAGTACCTCCTACAGCTATTGATGAAGCTTTGACTATGGTAGACATCAAGGCTTCGAGCAGGGGCGAAGCAAATGAAGTCGCCGAAGTTCCCGTTGA
AGTTGCTACGACCTCGGAGCTGAGTTTGAGAGAACGGGATAACGCGCAAGCTTCCGAGTTGAACCCATCCAACGGTCAATCCAATGCTCTGTCAAGCGAG
AATAACCCCGGAGCAATCGAGTTGGCGGAGAAAGAGATACTAATTGTGCAGAATGTTGCAACAACGGTTGCTCCTACTATCGTACCAGAACCACCCTCCC
CAAGCTCTCCAATTGCAGTTGCCCCGGAACCCAGGCCTCAAAAACAGTCGACGCCTAACGTCACACTTGTTCAAAATGCTCGTGACAAGATGCCGATCCT
CAGTCCATCCGTCTCAAGTGTCCTGCCAACAGTTGAAGTTGAACAATCTATCGAGCCTTTTCTTTTGAAAACCACGGCCCACACTGTTAGAGCAACACCA
ACTCTGCCCAACAGTAGGTTGGAACCTGAAAGTGGCGTACCTGAGCACCAAGTGATGGCACCACAAGTAACCCCAACGCAACCCACAGAAATCCCATCAC
CGATTATTGCCAAGGTGGACTGCGACTCGAATTCAACGTTGGAAATCGCCGACATACCACCCACTATCACGGAATCTATACCGATAGTAGTTGAAAAGAA
AAACCCGGGGCCTAAGTCTGTTGCGGTTGACGTGAAAAACACTGAGCCTATTGCAGCTGTAAGCACAACTCCAGTCACAGCAGCTCCATCCACCGCTAAC
GAACACGTTACTGCAGAGTTCAAAGGATTTGAAGTTTCTGGTGCGCCAATTCGACAACGTGAAGATAAAATACTACCACAACATGACACCGGTACTCCAG
AGGCAGTAGTAGATCCGCTTTTGCCGCATCGATCACCTTCACGTCGACGATCGTCAAAAATGGCCCAAAGATCGAGTTCTACAAAGAAGCATGAGGGAAA
CGCTGATAATGAACCCGCACGGCGCTTATCGATAAATAAACGCAGTTCGCACTCGCGACGCTCATCGATATCTCTACAGGCAAAGCCTGTAGAGCAGGAA
ACACCCAAGCCTGATCAGCGGATAGCACTCGAATCATCACCTGTTGAAAAGGCAGTACCGCAAGTAAAATTCCAGCCAGTTGAACAAGCAGAGCCTAAAT
TAATACCTCAACCTCAAGCAGCAGCCCCTATGACAAGCACTACAGAACAGGAGAATATCGAAGAGGAGAGTCAAGAAAGCGGCAGTGATTCCGTTTCTGA
AGGATCAGACTCGTCCAGTGGAGAAGAGCAAGACGCAGAAGCTGTAGTTGAGGAGATCTCAAATGCCATGACAGCTCTCAGGAAGCTTAAACGTGCTCAA
ATGCTATCACCCGAAGAAGAAACTGAGCTCAAAGAGCGTGCTCATAAGAAGTGGTTCCAACTCAAGGGCCATATCAAGGAAAAGCAGAAGAAGGACGTAA
CAAACATATTGCTCAAACGCAAGAAGAACGTCTTCACTGTATCGTCAAGGATTGAGTTGCTGGAGGAAAAGTCTCGCGAGATTTTCGCAGCACTCAAGCA
AATTATGAATGAATTGCGAGAAAAGAACGACCGCTCTACGCACGAAACTCTTCGACGACGTGTTGCGGATATTGAACAAAGCTTGCTGACTATAGACTCG
AGATTTGCGTCCCTGTCTGCTCCTGCCATGGATAATGTGCGTGACCTGGAGAATGAGGTAGTCTCACTCCGTAGTGCGGTGCAAATGCAGCTTACAACTG
CTCAGAGCGAGGCTGAAGCCAGGCACTCGTTACTTGAGGAAGCACTTGCAAGTCAGCGAACGCTGGTCGAGACATTAGCACAAGACGTTCCGGCCCAGAT
AAATGTTCAAACCGAGCTCTTTATGGAAAAGTTCAAACAATTGCCCGATCATACTGCAGCCATTGAGAATCTACGACGAAGTCTGAAGAGGAAAGCGGAC
TTGAAGTTGTTGAAAGAGTAGGTATCTGAGCTTGCCAGCTTGACGATCTGAACTGACCGTATGAGCTTTGTTTTGGTGCAGATTGGAAGCTCGCTTGCTA
GGTTTGGACGCTGAGAATGAAGACTGCCTCGTGCGCTGTTTATCGTGCCGCAAAGAAGTTATCAATCTGTATAATGACAAAGACACAGAAGCAGATGAGC
AAGATGTGGGCAATGGCCAGCTTCGAAAAGTGAACCCAGGACCATCATCAGCTCGGATCTACCGCTCCAATATTCCGTTTAGCGCCCAGACCGTCGTTCA
GGAATCCATCCAAGAGGAATCTTCCGAGGAAGTGTTATTTTCACCTCAACCCCTTTTCGCAATGCCTGATCCCCAGCCATATCAACAATTTCAGTCAGCA
GGTGATTCTCATTCAAGTGAGAAAGCTGCGATTCCAAGGTCGGCCCCCGTTTTGAGAAGAGATACAAAAATCCCTCAAGCGTCTCCGCTCAGGTAAACAA
GTCTCAAAATGTGTTTTACAATCGTGCTCAAAGATCTAACAGCGATTCGTTGTAGCCTGATGAATATCACAGCGACAAGAGCCATCTTGTCACCCGATCG
ACCGATTAGTGCACCAGTTGTGGCCTTGAAGAAGAGATCAACTACAGCAACTAGATCAAAGTCTTTGCTCAAGTCTCTTACTCCACAGCCAGGGACCGCG
CAGTAGCTTAATTAATCTTGTGCAGTTTTGCTCTTTGATGTGCCGTAGTCGTCTCGGTTGTTCTTGAAACCTCATGAAAGATGGCGATAGTGCCGCACAT
CACTTCAACAACACCAATTTTGGCCAATCGCTTTGTAGAGTTCATCGGATTGGACGATTCGCAACGGCAACTGTTGGTTGACCGACGAAACGGCTCGGCA
TACAAAGCGCAAGAGGTTTTTCTGACAGCCATTCGGTCGCCGCGAGTTGTCAGATGCATTGGCTGAATCTCCTCGCAAGTCCTCTCTTCCTTTGCCTCTT
CCTCTCCTCTTCTTGAACCATGTGTGGCATCATCGCGTTGATGCTTGCCAACAAGTACGAGCACTGCAACCAGGGGCTCTACGATGGTCTCACTGTGCTA
CAGCACCGCGGACAAGACGCTGCCGGCATCATGACGTGCGAGAAGAAGCGTCTGTTCCTGCGCAAGGACAACGGCCTTGTGCGTGACGTGTTCAAGCAGA
ACCACATGCTCAACCTGCGCGGCAACATGGGCATCGGCCACTGCCGCTACCCCACTGCCGGTTCGAGCTCCAGCTCGGAGGCGCAGCCGTTCTACACCAA
CTCTCCGTACGGCGTGGCGCTCGCCCATAATGGCAACCTCACCAACTCGCACGAGCTTGTGGATCAGCTGGCCAACACTAATTTCCGCCACGTTAACACC
GACTCGGACTCGGAGTTGCTGCTCAACATCTTGGCCGATGAGCTGCTCAAGCGTGTGGACCAGCCCCTTGACACGGAGATGGTGCTGGACGCTGTCACGG
GAGTCTTCAAGCGCTGCCGTGGTGGCTACTCGGCTGTCGTGCTTATTAACGGCTTTGGCATCGTTGCCTTCCGTGACCCGCACGGTATTCGCCCGCTCGT
GTACGGTACTCGCAAGACTCAGCACGGTACCGACTACGTCGTGGCCTCTGAGAGCGTCGCCATCGATACGCTTGAGTTCAAAACGGAGCGTGATTTTGCC
CCCGGTGAGGCTATGGTTATCAAGCAGAGCGGAGAAATGACCACGCGCAAGTGCGTGCCGGACGCCAAGCTGTCGCCCTGCATCTTCGAGCACGTGTACT
TCGCCCGTCCGGACTCGTTCATCGACGGTGTGTCGGTGTACCAGGCACGTCGTAACATGGGCTCCAAGCTCGCCCAGAAGATTCTGCGCGAACGTCCTGA
TCACGGCATTGACGTGGTCATTCCTATCCCCGACACAAGCCGCACGTCGGCTCTCGAGGCATCGCAGAGTCTCAACATTCCGTACCGTGAAGGTTTCGTC
AAGAACCGCTACATTGCACGTACGTTCATTATGCCTGGCCAGATCGCACGGAAGAAGACGGTGCGCATGAAATTGAATGCTATCCGCTCCGAGTTTGAGG
GCAAGGTTGTGCTGTTAGTGGACGACTCCATCGTGCGTGGCACCACGTCCCGCCAGATTGTGCAGATCGCGCGTGAGAACGGCGCCAAGGCCGTGTACTT
CGCTTCGGCTGCTCCTGCTATCCGTCACCCTAACGTGTACGGTATTGACATGCCCACGACGGAGGAGCTCATTGCCTTCAACAAGACGGAGGCTCAGGTG
GCAAAGGAGATTGGCTGCGAGTGGATGATCTACCAGGATTTGAAGGATCTTGAGGACTCAGTGCGGCAGGAGAACTCAGCGCTGGAGAACTTTGACTCGT
CGTGCTTCAACGGCAAATATGTCACGGGCGATGTGAACCAGGCGTACTTCGAGCGATTGCACGCTGAGCGTTGCGACGCGCGCATGCAGGCCAAGAACAT
GGGCTTCACCCCGTTCAACCGCACGATCTCCACCCCGCAGTCCGATGAGAGCATTGACATGTACAACGCTCCGCAGTAAACGTGTGAATCTTCCTAACCT
GGGCTAAGGTCGGAAGGGCCGAGGAGATGCCACCTGTACGTGGCTTCCTCATACTGAGTATGGTGGGGGTATGATGGACCCCTTCCTCTGTAGACTCTAC
ATAGAGCAAGAAATGCACACAAGTTTCTTTCCAAACGCTCTCAACACACCGAAGATAAACACTTCGAAGTAGTGTGTACTTAAGTATGTTGGAGAAGAGC
ATGCACTTCCAAAAAACCGCTCTTCTTCCTAGTGAAAACATAACAAATAGAACTTTCGTGATGGAATGCTGCTGCATGCTGCGCAGCATTTCCCCACATC
TTTGCGATTTCTGAAGTGTATGACGGACAGTGAAATTTGTCCTTCGATCCATGCTACCCAATCTACTGGAATGGCACGTTGTTCTGCGCAAAATACGACT
GCAGCGACGTCAACGTTGCGGGCGTCGGTAGTTTTGTCTGGGCGTACGCCAAGTGCTGGATAAAAACATAACAATGATAGTTAGATAATGCACTCACATC
AGCTTCGTAACACTACACGAAGAACTTACCACGCCAGGTTTAGAGGCTGACAGCTTCGCGATCGACTCGGCAAGGTAGCGTGATGGCACAGGGTATTCTT
GCAAGTGGTCAAGCGGAATCACCGACGCGAAGAACAGCTTTGCGTAACCAGCTTCGTAACCCGTCTGTTCCAGCTCCAGCAACGATTCATCCTCGTCCTT
GACAGCTGCACTAGTGTCTCCAGCTTCCTCAAGCACCTTCACTGCTGCGGCCAGCATCTCCGTCCACATATCCAAGTCGGCGCTGCAGAACTCCGTTTCA
CACATCAGTCGCGTCAAGCCAATAACGCAAGCCTTTCGTTCTGCGGGACTACGACCACGAGCATTGCACGGCAGCCACACAGACTTGATGAACATGGTCG
ACATTCCCTTCTGCAACGTCTCCAGAGACGCCAGGAACGTGTCCGGGCCGAGCTTTCCGATAAGCACGGACACCGTATAGATCAACTCCTTGGTGTAGCC
CACAGAGTTACGTCCGGCCATGCGCGTCTGTAGTCGAATCATAAGAATCTTCACAATTTCGTTCAGGAAGTTCGCGTAAGCTTCACGTGGCATGAACGCA
AAGAGCCCACGCAGTAGTGAGAAGGCGTTGGCTTCTGTCGATCTGGACGAAATCAGCTTCTGGAAAACACCGAGAATGCCTTGCACCGACTGAGCAACAT
CGTTCGGGGCCTTCCGCATGTACGCCTCGATGAGCTTCACAATAGCCGGCACGTTGCTGACTCGTTCCCACAATGTAGGGTTCAACAGCACGGGGAACAT
GCTCTTGTACGCA