Description :
From Genome Similarity Track
Location :
Scaffold_93:12022- 13995
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18838myosin-like protein

Sequence
1973 bases(100 bases per row)
GGACGTCGTAGAGGATCTGATTCAACTTCCGCACCTGCACGAGCCAGGCATTTGTCACACGCTGAACGAGCGCTTCAAGATCAACGAGATCTACACGCTC
ACAGGCGAGATCTTGCTAGCTATTAACCCTTTCCAAAACCTCGGCATCTACACCGACAAGATCACGCGCAAGTATATCCGCAATGGCGACAAGCGCGCGC
TTGGACAAGAAGTGCCCGACATGCCACCGCACGTCTTCAGCATTGCGGATAAGGCGTACCGCTCGCTTGTTAACCCAATCGGACACAGCTCCAATGGAGG
ACCAGCCAACCAGTCAATCCTGGTCAGTGGTGAAAGTGGCGCTGGTAAGACTGAAACCACGAAGTTCGTGATGAACTATTTGGCCACCATTTCGCAGCAC
AAGAACGCCTCAGCCGACAGCAACGTCATGAAACAGGTTTTGTCGTCCAACCCGATTCTCGAGTCTTTTGGTAACGCGCGAACGATCCGCAACGACAACA
GTAGTCGTTTCGGTAAGTTCATCAAGATGGAGTTCTCGTCGGAGGGAAGTCTTATCGGAGCGTCGATTCAGACGTATTTGCTGGAAAAGGTGCGTCTCGC
GTACCAGGCCGAGTCGGAGCGTAGCTACCACATTTTCTACGAAATTATTGCTGGAGCCACCGCGGAGGAAAAGAAGCGATGGAATCTCAAGGCGCCGACC
AAGTTCCACTATCTGAACCAGAGTACTTGCGTGAAGCGTAAGGATGGCGTGAACGATGCGGAGCAATTTGGTGTTTTGAAGAACGCCATGCAAACGATGG
GATTTGATGAGGACGACATGGAGAGCATTTTCGTCACAATCTCGGCTTTGCTGCACATTGGTAACTTGGAATTCGATGAGACACACCATGCCTCAGGTAC
GGAGGGATCTGAAATCTCCAACATGTGCGAAGATTCGATGAAGGTGGTACTGGACTTCCTGGAGGTAGACAAGGATGGTCTTGAACAGGCAATTTGCAAC
CGCAACATCCAGACCAAGGACGAGCACTACTCAATCGGGTTGCTGCCAGATGCAGCTGAGAACGCGCGTGATGCACTTGCGCGATTCCTGTATGGAAAGC
TCTTCGACTGGCTCGTTAGTCGCATCAACGAAATCGTGGAGAATGACGACCGCGATGTCCCGTTCATCGGTCTATTGGATATCTTTGGTTTCGAGGACCT
GGAGCACAACTCGTTCGAGCAGCTGTGCATTAACTTCGCGAATGAAACGCTACAGCAGCACTTTAATCGCACTGTTCTGCGTATGGAACAGGAAACGTAC
GAGAAGGAGGAAATTCAGTGGAGCTTTATCAACTTCCCCGACAATGGTCCGTGCATCGACTTGATTCAAGGCAAGCCGTTTGGTATTCTTCCCGCTCTTG
ATGAGGAATGCATTGTTCCGCAGGGTAATGATCAGAACTTCGCACGAAAGTTGTACCGTCAGCACGAGCTGAACCCGCACTTTAGCGCTAGCAAGACGGA
GATGGCCAACCACCTCTTTGTCGTACACCACTACGCTGGCGCTGTCACTTATGACACGTTCGGATTCTGTGAGAAGAACAAGGACATTTTGTATCCGGAG
ATCACTGCCATCATCAAGCGATCATCGAAGCCGTTCGTTCGTGGCCTTCTGCAGGTCTCGCCTGAAAAGAAGACACCGTCTAAGAAAACTAAGGGCCGCG
CTTCCAGTATTGCTACTCGCGTTAGTCTTGGTCTGCAGTTTCGTACTCAACTGAAGACTCTGCTGGAAACTATCAACGTCACTGATTGCCACTACGTGCG
ATGCTTGAAGCCCAACGACAAGGCCAAGGCCAACTTGTTGGTGCCCAAGCGTGTATGCCTCCAATTGAAGGCTGGTGGTGTCCTGGAAGCCGTGCGTGTC
AACCGTGCCGGATACCCCGTCCGAATTGCTCATCAGCAGTTTATCAAACGTTACCGTCCACTCGCCAACGGCG