Description :
From Genome Similarity Track
Location :
Scaffold_231:12021- 17339
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.17Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_231-fgenesh-gene-0.11CDC5 protein
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_231-abinit-gene-0.61Conserved gene of unknown function

Sequence
5318 bases(100 bases per row)
CGGGAGACCGGTTCAATCCTCGCGGAGTTCACGAGCTTAGACGCACTGCTGAGCAACGATATGGAGGAGAAGAAGCGGAAGGCGCAGCGTGCGGATAAGC
TACGCCGCCTGAAGGAAGAAGTGAGTGGCGCTCGGAAGCGAGGTGCCGTCGACGCAGGCGCGTCGCCACTCTCCAAACTCATGAGCGAGATGGAGCAGAG
CATGACGAGTCTCTCTGCCGAcAATGATATGTtCGCTGATGAGCTCcAGACTCCTCGCAGCCACGAAGAGAAGTTTGGTTTCGTGTTTACGCCCATCACG
GAGCCGCTTCCGTATCAGCCCTATAAAGCAACGCCTGCGGAATTACAGGGCgAGCTTCAGCTCGTGTACAAAGCGATGGAAAaCaCTGACGAAGAAGAAC
TCTCGGCACTGCTATGGAGCAAGGCCATTTTGCTCGGCGCTCTGCTTAACAGTCGGCAGGCTTCGAGTCAGGCAAAGTCGACGGCATCTTCGTCTGCTCT
CGTACAACCAGTTGTGCTTCCGTCACGTATCTCCTCCTGGATGTTTCTGACAAGTAAGTTTCAACAGCTCGGTGTAAACTTCCAAACTCTAAGACTGACA
TTGCGCTTCCAGTGTCGACACACAGCAACAGCCACATCGTCAAGGGCTGCCTCAGTAACTTATTCTCATTGCTCTCTGGTACCAGCCATCAACTTGCATC
GGTAAATATGTCTACGATAGGACTTCCCTATTCGTTATAGTCGCTAAAAGGGATCTCTACCTTCTAGGAACTGAAGTCTGGTCTAGACTGCGCAAGCTTT
tGTCACTCGGTACAGGATTTTCGAGCTGCGATCGGAGACGCACTACCCGACTTGCAAATGGAATGGCGCCCCACGGTATACGATTTCCTGAACGCGTTCC
GTCGGTTTGGCTTCCAAGACAGTAAGCGTTCGATGAGTGCCCGAAGTAAAATCTCCATCACGAAGAGCAAGGGTTCGTCCACTTCGTCCGGTCAGCAACC
GAATGCGAAAGGCGCACTGCCATTTCCGACTCTCAACATGCAGTATGTGCTGGTTTTTTtGGTtCTATGTCTTCGAACGAAGTTGTTACGGCTCGACGGA
TATGACGCCTTCAGCTTCACTATGTTTTTCCTGCGCATGCAGTTTGAACACAATATGCATCCGCAAATTGTCCAGCTGGCATCGATTTGCATTGAGGAGC
TTCTCGAAGTGTTCCCGACTGCAGAATGGCGCAAGGAaTGGGGTTCGTCTCTTGTACTGCGTATCGCTGGCGCAAACGAAGGCCTTTTCGACTCGGCCTC
GGGCTGGCTCACGGTTGCTCGTCGACTTCCTCGCACAAACCGTGGTACTCAGCTCACAACGGGACTCGCTGTCTATGTTCTCCAACATCGAATCGACAAG
TCGCCCGACGACGCGAACAAATCGGAGAGGCCATTGAAGTTCCCGATTCAAAGTGGCCTTGTGCTTGATATTGTTGCTGGAATTGTCGAAGATCTGACTG
CAAAGTATACGGAGAAGAAGAAGACGAAGAAGAAAGATGAGAAGACTCCGCCACCTCCATTTGATCTCTTGTGCAAAAaGGTTGCTCTTATGGATCTCGC
TCTTCAGGCATTCCTGAACGAACTCACGCAGAAGGAGATGTCGATCATGCTGAAGAAGCTGGACGATTTGACGAGTTCCCACAAGTCGACGATGAGCGCA
AAGTGGCATGAGGTAAATTCATGGATGAGGCTATGTACTTCTTGGTGTCCTGCAAATTGCTCACGGGGTCTTGTCTCTCTCTTCTCTTTTTAGCTGAAGA
CACTAGTGAGTTTGATGCATCGCAAATATTCTCTCGAGAATCTTCGTGTGGGCCGCCGTGATAATTCACCACGCGCCAAGGCAGTTCtCTTTCTGGATGA
CGATATTAAGGATGAAGTGAAGCAGGGGgCATGAAGGAGTTTtGTAGGCAAGCATTTtATATGAGgTGGGTCAATACAGTAGAGTGTGGAACGATGTCTA
GACCTGTTGTGCTAGTGCCGCGTACTGCTTTTGCAGCTGCACTTCAACGAGCTGCTGAGAGTTGACGTCGTTGGCGAgTCGGGTCATTCTGCTCTGTAGT
GCACTGGTCTCCAGTAAGGCcAAGCGATCGAAACACGCTTTCTCGATCTCCGCATTGCGCAACTCGGAATACAGCTCACGCAAACGAGCGAGAGCTGCAT
CCGTTCGCTTCGACAGACCGCCCGTCATCAACTTGATACGTTCTTGAATCTTGGTTGAGCGTTTGGTGAGTTGGGCTTCGACTTGTTTCAGCTCCTGGAA
CTCAGCCTGAAGGGCGCGGATTTTAtCCGAATCACTTGAGGCAAACGCAAACTCCACCTTATCTTCCGTTGACGACGGTGCTGTAGTTAAGAGGCGCTGT
TGGGTATCGCACCAcTGCTTAAGAaCTGCGTCCTGGTCCAACGAAGCCCACGGGTTCGCGTGGAGACTGGCCTCGATAGCAACTAaGTTGCGTGCCTTGT
CCATCTCAGCATCtGTAAACTGTTGCAACGCAACGGCCGCTGATGCGTCGTTTTGCTTGCTCTTGCTCTTGCTCTTCTTCTTCCCcTTGCTATCCGCAGT
GGCACCGCTAGCGTCCGGGTGCTTAATGATGTCGTACTGAATCATATCAAACATCTCCTTTGCAATGGCGTCGGTGGCCGAGTTGATGAGCGACCGCTTG
ATCTTTTGAGGTCGAGGGAGGTCCTGTTGAACAGCGTGTGAGCGACGCTTCAACTCGAGCTCAAGCTGACGCTGACGGTGCTGCTCCAATCGTGCCTCAC
GATCGCCGGCATCTTCTTCAAGCGCTCGTGCGTCGTCTCCATCTTCGCCGTTTTCATGCACTGGTATGCTCACATCATAGGCATAACGTGGTGCTGGCAG
ACTCTCCAAACCGCCCGCGAGCTCCGACTTCATCCGCTTGGCACGTGCTTTCTCCGCACGCGCGTTTGTCTCCATGCCATACAAATTTTCtGGGTTGATT
CCGAGTTCATCACGTAGTGGAGTTCGTAGAGAAGAAGCAGTTCCCACAGAAGATGGAGTCTGACTCGGACGACTCGGCGTACGCATCGGCGTGGCGCCGG
CGTATCCTGTGCCCTGCTTGAGCTCAATGTTTTCTCCTCCAAGAAGTGGTGTTGCGGCACGTGACATGGCTGCGAGGTTTGCGGCCTCCTGCATGATCGT
GTCATGCAAGTCCCGCGACTGAGAAGCTGTCGTCATGGTCTGAGCgCGGGGCAACGGCGTGGCGCTGTAGCTACCCATGAGAGCGCGTGTTGTATCAGCG
GCGTTTGGAGCACCCGACTCGAGggCAAGAGCCGCTGCATGTGCGGCGGACATGCCCAACTTGGCGAGGTCCGTGAGCTCTTCGTTCGATACAACAGGAG
CCGGCAGCTGCAGCGGCTTGCGCTTGATGGCGTTGATGGGGTCGTTTTTCTCATTCACAGCCGCGATAGCCTGTGGTAGGTTCGATTTCATCATTGACTT
ttGGCGTTTGGCATCTTGCTTTCGCATCTTCTCTTCCTGTTCATCACGACGTGTGCCTTCGAGCATGTCCAGGCGCAATGCCACCTGCTTGGGATCAAGT
GCCTGGTTCCGAGACGCTTGCTTCTCTTCCGTCACGTCAAAGAATCCAGCTGGGACATCTTTTTGGAACGGGATTTCGTTGGCATAGTCGATAAACTTGC
GCTTCTTCAGGTGCTGAACGCGGCTCGTGAGCCcTGCCGCCTTGAGTTCGCGTCGCTTCTGCAGCGCCGCGAGTCGCCGCGCTTCCTCCAACTGCTTCTC
ACGAGCCTTTCGTTTCGCTTTCTTACCCTTCGTATTGGCAAGACGCGCGCGTGCTTCCGATAGCATCTCCTTCTCGTCTTCATCCATGTCCACCGGGTCC
GGACGTGCCGGTTTGTTCTCTGGGTTGGGGTCGATCTCGCCAGGACGCAGTCGGCGTGGGTCGTCGCTTTGCACATCAACGCCCTCTTTCTGCTGCGCCG
CATCGAGCAGTCGCTCGTAGTGTTCCATGCACTGCGCGGCCGTGCGGCCGACAATGGGCGCGATCGTGCGCCACTGCGCTGGCATGAGCTTGGCGAGGTG
CAGCAGCTTCTCTTCTTCCTCGCGCGACCACTCGGTCTTCTTAATCGACGGGTCCAGCCACTCGTACCATCGGGCTTTGCACTGCTTGGCCGACTTGCGC
GACAGTAGTGAGGCCACCCGCGCCCACTGGTTCATGCCGTATTTCATCACGGCCGCCTTGAGGATTTCATCCTCCGTGTTCTTCCACACGCCGCCCTTGA
TCATGATCCTCATGATGCCTGTGTCTCTGTCTCTCTCCCGGCTCCACGCCGAGGCAACTACGCGGGGGgATACAGAGGAGCTCTTCGCCTTCTTGCTGGT
TGAGATGCCTGGCAGAAGCGCGGGGATGTACCGTGAAAGCGTATATAATACCTCCGTGGAAAAAGAGGGgTTAATTAAAAGAGCAGACCCGGGTGGGTCT
TGTGGGTTTGGGACCGTGGGTTTGGGgATCCATTTTGGAACGGAGCTCTTGGCATTCCCCACACGTCGCATGATGGACGAGCGGGGgCGGCAGCTGCAGG
CGCAGCTCCAGTTCATGGAGCGCAATGGACGAGCGCTGGAGGAAGTAGTGGCCAAGATGCTGCGCATGCGTGAGGACCAGGAGGCGTTCTATGGCGCGTT
CTCCAAGAGCCTCCAAGATATGAGCGCACaGGAAGACACCAAGCCGCTCTCACAATGCATGTACGCGCTCGGGTCGAGCAGCGCCAAGCTCGTGACCGAG
ACACACGATGTGATGATGATGCGCGCAGAGCCCGAGATtCTTCAGGTACTTGCACAGATCCAGGATTGGGGCATTGTGCCGATGAAGCGACTGTTAGATG
ACCGCGAGAAGGCGATCAAGATAGAACAGAAGCTGCAAAAGGAaTACGATGAGAAGAGTGTACGTGGAAAAGGAGAGAGAAGCACTGACGATCATAGCGA
TATCTGAACGGGTATTGTCCATGTGCTCGATATAGAGAAGCGGGTCGGGACGAGAGAAGGaGAAGAAGCTGCGCATGCTGTCGGACCAGCGACGACGAGT
TGAGAACGTCAACGCTTTGATAGACTTGCACATGAAGAAGTTTGAGAACTTTCGCACAGTCAAGCTCAAGGTTTGTGTAGTGCTGCTGGTGAGGACATGC
GATCCTATTCGTGCCTCATATAGCTCGGGGCTGTTTCCAACAGAAGGTGTTGTCAGAGATCGCACGATCGAATGCCTACTTCCACGCCAAAGGACTCGAG
TTCTTCGCTGTGCCATGT