Description :
From Genome Similarity Track
Location :
Scaffold_635:1202- 2303
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_635-snap-gene-0.5ATP-binding Cassette (ABC) Superfamily

Sequence
1101 bases(100 bases per row)
CACCTCCAGCCTTCCCAGCCAAGCAGCCACCATGCGTGTCCTCTCCGCCCTCGTCTTCATCTCGGTCCTCATCATCGGCGAGAGCGCCGCCAAGCTCTCC
GTCAAGGAAGAAACCAAGTCCATCGACCAACTCTATCAGGACGCCATCAACGAAGGCGGCAAGCTCGTGATCTACCACGGCGGCGACACCCCAACCCAGC
AGGATGGTCTCAAGGCTGCCTTTACGGCCGCGTTTCCAAAGATCAACCTTACCATGGTCGTCGACTACAGCAAATACCACAACGTGCGTGTGGAGAACCA
GCTCGAGACCAACACTTTGGTCCCTGACGTGATCGCGTTCCAGACGCTGCAGGACTTCCCTCGCTTCGCCGACGAAGGCAAGCTGCTCAACTACAAGCCA
GCCAACTTCTCGCAGATCTACGACGGCTTCAAGGACCCGAACGGCGCCTGGTTCTCATACATTATCTTCTCGTTCACGTACTTCTCGAACCAGCAGGTGC
TCAGCTCGCTGCCAGCACCGGCCACGCCGCTCGACTTGGTGAACCCAAAGTACAAGGGCATGATCGCGTCNNNNNNNNNNNGCGGCGACAACAAGCCTGC
GGTTGATGCCAAGTTCCCGTTCCTCGCCTGGGGCCAGCGCGTGNNNNNNNNNNGCGCAGGACGTCGCATTCAGCCGTGGCTCGAATGTGGCTGGTGAGGT
CGTCCAGGCTGGCAAGAAGGCGGTCGCTGTCGGCACCGACGGCGACATCAAGCCGGCGGTGGACAACGACTACCCGTTCCTCGCCTGGGGCCAGCGCGTG
GCGATTCTCAAGAAGGCCAAGAACGTCGCGGCTGCCAAGCTCTTCGCCAACTGGATCATCAAGGAACAGCGCACGATCAACTACTCGGGTTGGACCGTCC
GCAAGGACATGGCGCCAACCAACGGCTTCAAGCAGGTGTGGGAGATCCCGAACGCCGGTGTCGCCGACTTTGCGGCCTTCATGGAGGACCGCGAGCGCGT
CGAAATCTGGAAGCAGACGTTCGCGCTGTACTTTGGCGAAGTGCATGGCGAGCCGACCCCAGGTCAGCTCGGTCTCCACCCAGGACTCTAAACGTCCACC
G