Description :
From Genome Similarity Track
Location :
Scaffold_107:120197- 124053
Transcript NameFunction/comments
Hyaar_Emoy2809685RING zinc finger-like protein
Hyaar_Emoy2809686hypothetical protein
Hyaar_Emoy2809687protein kinase, putative

Sequence
3856 bases(100 bases per row)
AGTGATCATCATGGGTCACACAGCTAGCACCAACAGACGGCAACCTCGCATTTCGGAGACGACTCTAGATGAAGAACCGGAAGGAACCGCTGCAGCAAGT
CGTGGAAGCTACGCACCAGCACAGATGCAAGCGGTATCGACGACTCGTGAAAGACCAGACATGGCCTTTATATCTACGAATGATGGAGTGCACAAGCCCA
TCGGTCTTCCAGAACTACAACAATCAAGCACAATTACGAACCACGTGAACCTGAACAAGTCCAGTCTGAAGCTGGAACGGTCGATTACAGAACCGTCACA
GTACGCACTGACATTCAAATTTGACGCGACTAAAGCATGTCGGATCAGTGTGTACTTAGTGGCAGCTGAGATCGTCGAAGCTGGAACTGGCAACTTGAGT
TATGCTCTGACTTATGCAGATAAGATCCCGATTCTGGCTCAGCACTTCTCTCACGGAATGAGGCAGACTTTTGTGCTCAAAGGTGGAGAGAAGGAAGAGC
AGACACTTACGAAGGACCGTGAGAAGCTTGAGCACCCAGGGTCGTTCTTGGACTTCTCAGGCTATGACGCTGATGATCTGGTATACAAGGCTGACGAGAG
ACAATTTCCACTAATTATCGCGCTCGAAGTGGTGTCAGACGGTAAGTTGTTGCAGCTTGATTTCGTCGCTATCCTTGGTGTTCATCCGTTGCAATGTCGT
TCACAGGTACATTTATCCAGTCCCAGTCGACTTTCTGCTCATTTTTTCGGACCGCTGAAGACAACTGGGATGTCAGGGTGGTCAAGCAAAAAGTTCGGGT
AAAGGCAGCTTCCGGTCTGAGATCCGATAGTTTTCCTATCGACTAATGCTTGTGTCTTCCGGTTAGGTCGATGGGGTGACGTACGAAGTGCAGGAGATTT
ATGGCATCAGTGCATCGGTAAATATAGCTCCCGAAACTAAGCGAAGCGATAGAGCGGAGGACGATCATGTTGGCATAAGTCCATCGACTGGATCTGGGAT
CGGACTGTCTCAAGAAGCCGAATGCATCATTTGTTTGTGTGAACCGCGCGATACTATCATTCTACCCTGCCGCCACATGTGCCTCTGTAGCGACTGTGCA
GAAACACTAAGCAAGAGGTGTAGCATGTGCCCAGTTTGTAGAACGCGGGTCGAGGCGATGTTACAAATGCGCGTTGAAGTATAGGAGACGCTGAACTTGA
GTAGCTAATGCTCTGTTCAAGGTAATCGACGTCCAGATGTTGTACAATCTAGAGGCGCACACTGAAATGTCTCCATGGCACAGTGGCGAAGATCTGAGGG
AATACTACATTGTTGTGTTGCGGTACGTATGACGATTTCTTGCAAGTCCCAAGCATGACAAAAGAATGATCATTAACTGTGGTCCCTTCCTGCTTCTTCC
TCTCCTCTCCCTGCGTAAATGGACCACCGGACCAAAAGTTTCCCCTCGGCTTTCCGTCCTAGTCAGTCCTCCACGAATGATCAGGCTCTCTATTGGTGCT
GATCTAATCTTCGCGCATGGGTGATACCTTCGCTTGTCACGGCCTTGCAATTGGTTCCGTGCACTTTGTTTTTTTCTTGATGATTTTTGCATGTTTATCT
TGTACAAATACTGACGGCGCCGACGGCTCGAACTTGAAGGTGGAAGAAACATCGACAAACCTCCGCCGCGTGTCACTATATCTGCGCCTTCATTCTCGAG
TGGTTACACCGAAACACATGCAGATAATACGCTGGTGTTGCACGGCATCTCCTACGCTACCCTGGCCTGTGCCCAAGCTCCCTCCCACAAACTAGAGCCA
ACTGGTGTCGTGTTTTCAGGTTCCCTCGTTTGGCCTTGGACTGCCAGACGCCACCTAATTGCTTTTTTTCCACATTCCCTTCATCTGTACATCCACATGA
AAACAAGTAAGCTACAGTATCGGACTTCTAAACAGCACAAAATGAAGTCGTACCAAGTTCGCCACTTGCTCGGGGGCGTCACGAAGTCGGTTCGCGGTTG
ACGGAGTGGCACTTGCATCACCTGTTGAGCCATAGTACGGGCTGCTCTGGCCTTTGGCAGGATAAACCCCACCACGCTGAGATCTTATTTGAACCTCTTC
TACTGCGGCTTTCGTACTCAGGTCTCCTGAAGACTGCGACTGAAGACCGCCACGAGTAGATGGACTACCACCGTTAATGTCTCCCCGTCGCTTAGGGCTC
TGAGGGCCTCCTTGGCTAAAGCTGTTATCTGCACTGGAATTCGAGTCATCGGACATAGTTGGAGATCCGACCTTAGCTGCGTTGCTCGACAACGACCGTG
TCATCATCTCGACCATTTGCTCGCGTTTCTTCAACTCACTCTCACGACGCATGTAGTCTACCTCCAGCTCTACGTATCCATAGAAATAGTCTCCATCAGA
TTCAACACAAAGTACGCGATGAGAACATAGAAACCTTCCCCACCTTTCAGTTTCTTTTCACGTGCCATCAATGCAGCTTCTTGTCGACGAAGGTCTTCTT
CGATGCCCAAAAGCTCCTTCATCTTTTGGTTGTACGACGTCTGCAAATTCGGATCAGCAGCTGCCGGTGGCGCATTGGCCGCCGAGTATGCGCGTAATCT
CTGTTGCAGCTGTGGCACACGCTCCAAGTCTTCGATTCTCGGTCGTCGAGAGCGCTGCCTATGGAGCATCCATCGAATGACCTGGAAGAGACCCTCCGAG
TATTGTGAGGGGATACGCGTAAACTTGCCAGCGTTGATTTTTTTGGCGAGTGCCAACTGATTGGTTGCATCAAAAGGTGGGCCAAGCGTAGCCATTTCGT
ACAGCAGGCACCCCAGCGCCCAAATGTCAGAACGGTCGTCGTATGTCATCTCATTCACCATCTCTGGGCTCATGTAGTACGGGGTTCCGACGTTTGTCTG
TGCAAAACGAGACTCGCTGCTCAGCTCCTTGGCGAGACCAAAGTCACCAAGCTTCGCATTGTTCTAAGTTGAAACAAAGAAGCTGTCAGCAACTTACAGG
TATCACATAGCCACACAAACAACAGTAGTACAATACGCTTCGTACGTTCGAGTCTAGAAAAATGTTGCCAGGTTTAATGTCGCGGTGGAGAATGGGGCGA
ATGACGTTGCCTTCGCGGTGACGGTGACATTCCTTCAATGCCAAAAAGATATGCGTAAAAATGTGCCAGATGAAGCCCTCTTCGATGTAGGACCTGCCGA
GGATCCAGGATATACCAGTCAGCAATCAACTCAATATCAAATACGGTTTACCCGAAACCAGTAAACCACATCAAACGTACCCCTCCCGCTTCTTCCGTTT
AATGAACTGGCCAAGATCGCCGCCTTCGCAGTATTCCATGACAATGTAAATCCTGGTCGCCTGCTTGTCAATCACTCGGTCCAAGTAGCGGACAATGTGC
GGATGACGCAGCTCTCTCAAGATGTTAACCTGTTCGTTCATCCAACAAAAGATAGATACGAAAACCACATTTATTATAAAAACCATCAGCTACGTCACTC
AGGCGAGGGATAATAGCGACCACTCAATCAACGCACCTCGCTCACAATGAGCTGTTTCTCCTTCTCACTCATGGCTCCATAGTTGACCTCTTTCCACACG
AGCATCTACCCCAACCACCGACAAATACATACACACACAAAAATAGCAAATAGACAAATAAAAACAAAAATAGACAGAAGACACGTCAGTACATTAATCT
CCTAAGCTCTGGACACGTGTGTGCGTGTCCCCCCTCCCCCTAAGTGTCGCGTCTGCCCTCACCTTGCGATCAGCTTTGCGCACAATCTGCGTGACGACGC
CAAAGGAGCCCTTGCCGATAATGCGGATCTGCTCATACGCGTCCATCCTGACGGCT