Description :
From Genome Similarity Track
Location :
scaffold_14:12019- 16220
Transcript NameFunction/comments
Plaha_PHALS_08152RxLR-like protein
Plaha_PHALS_15283hypothetical protein
Plaha_PHALS_08153RxLR-like protein

Sequence
4201 bases(100 bases per row)
ATACCTTACAGTCGACATAATCAAATATCTACATATGAAAAATGTGGTAAATCATATAAGTCGTGCGAGTATCTAATTCATTCAAGCACTTCGAATTAGC
TTCTATCAGTGAGCAAATTCCAAAGAATATTGAAAGCATATCATACTATCAGTAAACATATGTAAGATAGTTGAAATTGAGTTCAATAGCTCAACAAACG
TCTGCTTTTGGAGCTTTGAGAACATCGTAAGTACATTTGCAGCCCAATACAATATGTCTTAAACTTCAAATTGACGTAACGAGTTATGTAATGAAGGTTA
GTTACTCAACTTGCATCGTAACACTTGTTTGATCCTCTTTATCATCCTGCTAGCAACACATCTCATAATTCAGTAAAGAAACCGTGTCTCAGTTTCTAGA
GAAAGTACCATGTAAATTATATGATAGCAAAGTGTGCTTCACCGATCATTCAAGCAGATCCTATTTCCTTGCTTCCTTAGCCCGATCACCATTTTCGAAT
TTTCCACGGTCTCCATAAAAGTTTCTAGTTAACTTGCTGCTATGATCACCTGGCAAACTGTTGGTCTCCTCGCTGCTACTGCCGCCATTAACCTCGCAGA
TGCCAAAAAGCTTTCGATTGGCGTGTGCTACGTCCCATGGCACAATCCACTTGTCAATTGGGATGTGATTTCAACTGACTTGGCACTGGTCTCGCAGCAT
TTTTCTAGTATCCGCACGTATGAAGCGCAATTTGGTAGCATCAATGCCATTAGCGTTGCAGCAGCTGCTGGTCTTCGTATCGCTGTGGGGGTGCAGCTTG
CAGACCCTCAACGCATTGATTCCGAGATTCAAGCAGTTTGTGCTGGATACGCTCAGAATCCATGGGCGGTTGAAGCTGTTTACGTCGGCAACGAGGATCT
AAGACATGACAGCTTCGGTAGTTACACGGTCGATCAGCTTAACGGCTACATCCAGGCTGTAAGGAGTTGTGTTGGCAACACCCCAGTTGGTTCGGTTCAA
CGTGTTGAAGAATGGCTAAACGCTGAGGGTTCAGTAGCTTTAGCAAGCAATTGCCAAGTCATCGGTGTCAATATCCATCCATTCTTCATGCCAGGTGCCG
AATCGCCGATTGAAAAGCTTAACTTTCAATGGCAGCAAATGGCGAACAAATTTGGTGCGGAGAAACTCCGTCTTACGGAGACAGGCTGGCCGTCCGCTGG
TGAAAGCTATGCTGGCAACATCCCATCGACTGGTGTTTTGACGCAATACTTTTATGACTTTGTCTATGGCTGGTGCCCTAATAGAAGCCAGTCGTACTGG
TTTATGATGTACGACACTGCGGTGAGTTACTCGGGTGCAGAGTACGACAAACACTTCGGCCTCTTTGGAACGGACAGATCGGAGCATATTACTTTGCCAT
AAGTTCACACCTTGCTGTATCTTGTTCGTTTTCATAAGTAATTGAACGACCAGCAGTGTTTCCACTGCCAGAAAATGAGTAAAAGCGTGAGGAGACGTTT
TGATTATACAAGATGCTTGAACCTCTGGAATACGACGAAGATTTTGACAGCACGTATCGTTGTTATAAGACCCACAGTTAATCAACATCTCTATGTCGAT
TAGATCTTTTTTAAAGTATTATGGAACGCTTTCTTGCTATACCTCAGCATATTCTTAGCAGAAGCGTAGCTTTAAGTACTTTGGCATCAGTAGACAGCTC
TCACAACTCAGATCAAAATTGCTGCATGGAAAGATACTATACTAGGCATCCTTCTCGTGCGATAACATTGAGCGAATTTCACCAGAATAGTTCGGTTTGG
ACTTACGCTGACTTCGATGTTCAGGAGTGAGGAGCCTTGTCTCTTGGATATGCGTTTATGTTTATTACTTACTAAAGCATCGAAAAGTTTCAGCAGCACA
TTCTTTTTTAACTCAGTAGACAATTCCTTGTATGATCAGAAATTCGTGATAGTGCTAATAACAGCTCAGCCTTGATCGCTAACATCGCACCTCGATCATA
GAGCAGTAATCTGCTGAAAACGATTTTGTTGGCAACGTAACATCAACGTTTGCTCCTTGGCAATTCTCACTGAACGACAGCTATCACAACACTACCCCGT
CAAACTTAGCTTTTAGCAGTACAGTATGACCGTATTACAATAATACgtacaaattttgaaatttacAATCCGGATTTATTTGAGGACATTTGTCATCGAT
AAAAACATGTTTAGGAACCACTTCGGTGGTCATCCGTAAAAAATAAAACATGTTCATTCTGTCCAAATCAACCGACCCGTCGGACACATTAGTCGTAAAA
TTTGAAGCAAGTCGCACGTGCGCATGTGTGAGTCCATGAATGCAAGCTTATCATCTTTTGCGGCGAAAATCTTAGCCCTGTTTGTACAGGGCACATACGT
AATTGTATATTAAGAAATTTGCAGAAAGTATGTGAGTAGAAATGTTTTGGCAAAACACAATAACGAGTAGAATGATCTGCCCTTGTTTGTGCAGCAAATG
TTTTTCAAACAAATTATCGTTGATGAGCTTATTGTTGCCAGAGATGATGACCAGCTTTGTTGGCTCTCGAGATCCAAATGTCGGACTATCCACGATGAAG
GTCGCAATCAGAAGCCAAAACGACGAATAGTTTGTGCATTCATGACCAATCAGGACCAAATTCTAATTCCTTGCGCACATCAATACTGCATTTAATGCAC
ATCACATTCGCGCTTTGAGTAAAGATCACTAACTAATAAGATTTATTCTGGTGTCACATTTGTCAAACGGAGTATCTGTGGTGCCAACCAAAGTGTACTC
AGTAATGTCGATTATGATTTTGGCTTTCTTAAGGCCAAAACGAAGATAGCTGTTCGCTGACGCAAGATATCTATTCCCTGACGCATGTCTTGTCACTTAG
CACGTACCTAATGAAGCCATCAAACGCCTTAGTCCAATTAAACAACCCATTAGAATATTTCATGTAATCGCAACATACCCTGAATCTTTACAGACATAAC
TAGAATGATAAGCGTCGGAAGTATCGCTCGAGtctgaacgaaaatgttaTTTAACTATGATGAACCCAAGGATTGTCAATTCCAAAAGCCGGAACTCTAC
AGTCGACAGCTTTATGGCCAGGGTCAGGAAAAAGTCCAACATTTGAGCTCTGATATTTATCTTAACATACTTTCTGTCTGTGAAATACAAGATAATGAAT
TTTATTAATTGGTCTTTGTAATGAGAGTGTAATGCTCTACATATTTATCATGTAATATTTACATTAGACTTGTATTTCGACCTTAACAGATCCCATACAG
AGGTTACTGATAAAATATGTGGAAAAAAAGAAGCTGTAATTATGGCTGTAAACGTTCCCGCTTGCAAGGTACTGAACAGATTCGAAGATTGGCGATATTC
TTGTAGCCAAGCAGAAAGAGTTCGGAAATTCACGATATACCTTGCGCAACCTTTGGTCTTGAAATGATCGAACTTGGTTGTAGCGATCTCTCACGTTTTC
ATTCTTCATTCCTcaattttcttgttgcccGAACACTTTGATCTTGCGCTTAATCAGCCGAATGAAGTTCGCAATTACCCTCGCTGGTCTCGTAGTCAGC
CTTGCTGACGCTAAGCTAAGTACTGGTATCTGCTACGCTCCATGGCACCACACCATTATCAATTGGACTGTGCTGCAGGAAGACATGAGGCAAGTAGCAC
AGTACTTTTCAAGTATTCGCACGTTTGAAACAGTTTTAGCTGGTGTGAACGCGATTGACATGGCTGCAGCTGCTGGTCTTCGTATCGCTGTGGGTGTGCA
ACTAAAGTTTCCTGACCGTATTGATGCTGAGATCCAAGCTGTCTGCGATGGGTATGCTCGAAATTCTTGGGCTGTCGAAGCCGTTTACGTTGGCAACGAG
GATTTGCGAAATGGCAATCATGGCAGATACTCATCTGAAGAGCTTGCTGGCTACATCCATCGAGTGCGTGCATGTGTGGGAAATACGCAAGTTGGTTCAG
TGCAGCGATCCAATGAGTGGCTAGATGAGAATGCGTGGAAACTCGCAGATCACTGCGACTGCATCGGTATTAATATCTACCCATTTTTCACGCCTGGCTC
GCAACCTTCGATTCAGAAGCTACAGACACAATGGGATCAAGCAATAGCAAAGTTTGGCCAAGAAAAGGTTCACCTCACAGAGAccgggtggccgagggct
g