Description :
From Genome Similarity Track
Location :
Scaffold_199:120184- 123563
Sequence
3379 bases(100 bases per row)
GGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAGCCTTCACTTCTGGGTCCGAGAAGTAGAGCTGGCGATGGATGCGGCTCTGATCTCGACCGA
GCAACTTCGTGCTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGTGTTGGGTGTACACACGGGAGGCAACATCCCCTGGATGTTTCACATCCTGG
GCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAGCTACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGCAAACAAGGGAGGCGTGAAC
TGCACGAGTACGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAGCTAACACATCAAGATGACTGTGTTCATGGACGGCCTTCG
AGTGGGATCCGCACGCACTCAGCTGTTCCGGGTGCAGTCCAACACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGGGTACAGCCATCGCCAGGCG
CGTACGCCGGTCTCTGCGTGGCCTGGGAGTTCCTTATCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGC
GTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAATCGTGACTGCCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAA
GGGTCGCTGGCAAAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGT
GCGTGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAATCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGT
ACGGAGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGATGCTCGTAGCAGCAACAAGTTGTCC
GATGCTTTGAGAAAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCA
AGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTG
GATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCC
CGCGAGGGCTGCCAGGGTACCAAGCATCCGGCAGATGCTTGGCAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTTATGGTGGCCGCGCCCAGAAG
AGGCGCCGGCCAGGTGGGTAACTTAGGTCCACAGGCGGGTACCTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTG
GGTAACAGAGTTCCACTCAGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCA
GACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCC
CTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGGCGCCGCCGCCGCCTCAAGTCGGATTCGAACTACGTTCCGATCGACGTCGCTT
CAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACAACTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATC
TGGTGTCCACTTGAAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGTCGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATT
GCTGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACGCCTCCTCTGTCTAGGACGAGAACGTCCTGGAAGACCTAAACAAGCAGCGTC
AGACGCGCTTGGGTTCTGAGATCCTTAAGAACCCCAAGGATTCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCA
ACTTCCACCGGATCGAGGTGTACAGCATGAGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAG
GTCATTGATGCCTTCTTCGCCGCGAAAGCGAAAGCGAAGGCAGGCCTGGTGTGGGAGTCGAAATCCCCGCACTCGACGCCACCTTTCTGCGTTCGGAAGC
CGAACGGAAAGTGGCGTCAAGTTCATGCTTCTAACAAGCTGAACAACGCGACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTAAACAA
CATGGCCGGAAGCGTACTGTACACTGCGCTGGATTTGGTAGACGGTTACTAACAGATCCTGATGCGAGAGAGCGACATCCCTCTCACCGCGGTGAGCACT
CCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTAGTCTAACGCCCCGGCGACGTCCAAGCGTCTGGTGACGCAATTGTTCCGCTCTTTGC
GTACCTTCGTACAGACGTTCTTCGACGACATGTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGT
GTTGGACGTAATGCGAGCAAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTTGCGTCACCAGATATTAAAGTTCTCGGTTGTTTCGTAAGCAACGTG
GGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATTGCAGCATGGCCAACGCCCCGATTTCAGAAGGATCTTCAAAAGTGGTTGGGCTTAGCCAGCTACC
TTCACAAGTACAGCGCGGGGTATTCGGGCTTTGCTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCACGAGCACCAGGATGC
ATTTGACAGCATCAAGGTCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCAGCTGCGATGCCTCCGATTACGCC
ATCGGGTGTGCATTGCTGCAGGCCGACACGGCTGGACATGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCAAACGAAACTACCCTGTCG
ACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAATTTTCGTGTTCACCTTCTGGGCTCCCTGCCCTTCGTGAT